Advertisement

Rotavirus infection of cultured intestinal epithelial cells induces secretion of CXC and CC chemokines

  • Antonella Casola*
    Affiliations
    Departments of *Pediatrics and Internal Medicine, University of Texas Medical Branch, Galveston, Texas; and §Department of Molecular Virology, Baylor College of Medicine, Houston, Texas
    Search for articles by this author
  • Mary K. Estes
    Affiliations
    Departments of *Pediatrics and Internal Medicine, University of Texas Medical Branch, Galveston, Texas; and §Department of Molecular Virology, Baylor College of Medicine, Houston, Texas
    Search for articles by this author
  • Sue E. Crawford
    Affiliations
    Departments of *Pediatrics and Internal Medicine, University of Texas Medical Branch, Galveston, Texas; and §Department of Molecular Virology, Baylor College of Medicine, Houston, Texas
    Search for articles by this author
  • Pearay L. Ogra*
    Affiliations
    Departments of *Pediatrics and Internal Medicine, University of Texas Medical Branch, Galveston, Texas; and §Department of Molecular Virology, Baylor College of Medicine, Houston, Texas
    Search for articles by this author
  • Peter B. Ernst*
    Affiliations
    Departments of *Pediatrics and Internal Medicine, University of Texas Medical Branch, Galveston, Texas; and §Department of Molecular Virology, Baylor College of Medicine, Houston, Texas
    Search for articles by this author
  • Roberto P. Garofalo*
    Affiliations
    Departments of *Pediatrics and Internal Medicine, University of Texas Medical Branch, Galveston, Texas; and §Department of Molecular Virology, Baylor College of Medicine, Houston, Texas
    Search for articles by this author
  • Sheila E. Crowe§
    Affiliations
    Departments of *Pediatrics and Internal Medicine, University of Texas Medical Branch, Galveston, Texas; and §Department of Molecular Virology, Baylor College of Medicine, Houston, Texas
    Search for articles by this author

      Abstract

      Background & Aims: Rotaviruses are the major cause of pediatric gastroenteritis worldwide. The target cell of rotavirus infection is the mature enterocyte of the small intestine. Recently, intestinal epithelial cells have been shown to produce chemoattractant mediators in response to cytokine stimulation and bacterial infection, suggesting a potentially important role of epithelial cells in initiating immune responses. In this study, the production of chemokines by cultured intestinal epithelial cells after rotavirus infection was investigated. Methods: Two human intestinal epithelial cell lines (HT29 and Caco-2) were infected with sucrose-purified rotavirus (strain SA114F) and assayed by reverse-transcription polymerase chain reaction and enzyme-linked immunosorbent assay for chemokine expression. Virus-like particles and inactivated rotavirus were used to test the importance of viral attachment and replication. Results: Increased messenger RNA expression and secretion of immunoreactive interleukin 8, growth-related peptide α, and RANTES (regulated upon activation, normal T cell expressed and secreted) were detected in rotavirus-infected cells. Chemokine production was time and dose dependent and required viral replication. Conclusions: Rotavirus infection induces the expression of a subset of chemokines in intestinal epithelial cells. These data support the hypothesis that chemokine secretion by enterocytes may play a role in the initiation and modulation of the immune response to rotavirus infection.
      GASTROENTEROLOGY 1998;114:947-955

      Abbreviations:

      ELISA (enzyme-linked immunosorbent assay), GRO (growth-related peptide), IL (interleukin), LPS (lipopolysaccharide), MCP (monocyte chemotactic protein), MIP (macrophage inflammatory protein), MOI (multiplicity of infection), PCR (polymerase chain reaction), RANTES (regulated upon activation, normal T cell expressed and secreted), TNF (tumor necrosis factor), VLP (virus-like particle)
      Rotaviruses are nonenveloped, double-stranded RNA viruses, belonging to the Reoviridae family. Since their first description in association with human disease,
      • Bishop R
      • Davidson G
      • Holmes I
      • Ruck B
      Virus particles in the epithelial cells of duodenal mucosa from children with acute non-bacterial gastroenteritis.
      • Flewett T
      • Bryden A
      • Davies H
      Virus particle in gastroenteritis (abstr).
      rotaviruses have been identified as the major etiologic agent of diarrhea in infants and young children and the most common cause of severe gastroenteritis, causing more than 500,000 deaths each year in developing countries. Rotaviruses have a rather limited tissue tropism, infecting the mature enterocytes lining the villi of the small intestine.
      • Greenberg H
      • Clark H
      • Offit P
      Rotavirus pathology and pathophysiology.
      Under normal conditions, the gut mucosal epithelium represents an important interface between the external environment and the host, whose main functions are the absorption of nutrients and the defense against infectious agents. Although intestinal epithelial cells have been identified primarily with the absorptive/secretory compartment and immune cells with the mucosal host defense compartment, there is growing evidence to suggest that gut epithelial cells may also contribute to the mucosal immune response. This activity appears to be mediated by soluble factors produced by epithelial cells, including cytokines that regulate communication among cells of the immune system.
      • Eckmann L
      • Jung HC
      • Schurer-Maly C
      • Panja A
      • Morzycka-Wroblewska E
      • Kagnoff MF
      Differential cytokine expression by human intestinal epithelial cell lines: regulated expression of interleukin 8.
      Chemokines are a novel class of small cytokines that are able to recruit and activate leukocytes and have a significant role as potent mediators of immune-inflammatory responses.
      • Miller MD
      • Krangel MS
      Biology and biochemistry of the chemokines: a family of chemotactic and inflammatory cytokines.
      • Strieter R
      • Koch A
      • Antony V
      • Fick R
      • Standiford T
      • Kunkel S
      The immunopathology of chemotactic cytokines.
      • Bacon K
      • Scall T
      Chemokines as mediators of allergic inflammation.
      Two subfamilies, the CXC and the CC chemokines, are defined by the splicing of the conserved cysteine residues, which are either separated by one amino acid (CXC chemokines) or are situated adjacent to one another (CC chemokines). Interleukin 8 (IL-8) and growth-related peptide α (GRO-α), belonging to the CXC family, are mainly chemotactic factors for neutrophils but also for monocytes and lymphocytes.
      • Miller MD
      • Krangel MS
      Biology and biochemistry of the chemokines: a family of chemotactic and inflammatory cytokines.
      • Geiser T
      • Dewald B
      • Ehrengruber MU
      • Clark-Lewis I
      • Baggiolini M
      The interleukin-8-related chemotactic cytokines GROα, GROβ, and GROγ activate human neutrophil and basophil leukocytes.
      • Larsen C
      • Anderson A
      • Apella E
      • Oppenheim J
      • Matsushima K
      The neutrophil-activating protein (NAP-1) is also chemotactic for T lymphocytes.
      The CC chemokines include monocyte chemotactic protein 1 (MCP-1), macrophage inflammatory protein 1α (MIP-1α), and RANTES (regulated upon activation, normal T cell expressed and secreted) and are chemotactic factors for monocytes, lymphocytes, basophils, and eosinophils.
      • Miller MD
      • Krangel MS
      Biology and biochemistry of the chemokines: a family of chemotactic and inflammatory cytokines.
      • Rot A
      • Krieger M
      • Brunner T
      • Bischoff SC
      • Schall TJ
      • Dahinden CA
      RANTES and macrophage inflammatory protein 1α induce the migration and activation of normal human eosinophil granulocytes.
      • Schall T
      • Bacon K
      • Toy K
      • Goeddel D
      Selective attraction of monocytes and T lymphocytes of the memory phenotype by cytokine RANTES.
      Recently, gut epithelial cells have been shown to produce chemokines after stimulation by cytokines or after bacterial and protozoan infection.
      • Eckmann L
      • Jung HC
      • Schurer-Maly C
      • Panja A
      • Morzycka-Wroblewska E
      • Kagnoff MF
      Differential cytokine expression by human intestinal epithelial cell lines: regulated expression of interleukin 8.
      • Eckmann L
      • Kagnoff MF
      • Fierer J
      Epithelial cells secrete the chemokine interleukin-8 in response to bacterial entry.
      • Crowe SE
      • Alvarez L
      • Dytoc M
      • Hunt RH
      • Muller M
      • Sherman PM
      • Patel J
      • Jin Y
      • Ernst PB
      Expression of interleukin-8 and CD54 by human gastric epithelium after Helicobacter pylori infection in vitro.
      • Jung HC
      • Eckmann L
      • Yang S-K
      • Panja A
      • Fierer J
      • Morzycka-Wroblewska E
      • Kagnoff MF
      A distinct array of proinflammatory cytokines is expressed in human colon epithelial cells in response to bacterial invasion.
      • Rasmussen S
      • Eckmann L
      • Quayle A
      • Shen L
      • Zhang Y
      • Anderson D
      • Fierer J
      • Stephens R
      • Kagnoff M
      Secretion of proinflammatory cytokines by epithelial cells in response to chlamydia infection suggests a central role of epithelial cells in chlamydial pathogenesis.
      • Yang S-K
      • Eckmann L
      • Panja A
      • Kagnoff MF
      Differential and regulated expression of C-X-C, C-C, and C-chemokines by human epithelial cells.
      Furthermore, IL-8 and RANTES have been found to be the most potent chemoattractants for intestinal intraepithelial lymphocytes.
      • Ebert E
      IL-8, RANTES, and GRO are chemotactic for intraepithelial lymphocytes (IEL).
      These findings suggest that intestinal epithelial cells can act as an early warning system for the mucosal immune system. Respiratory viruses have recently been shown to induce chemokine production by infected airway epithelial cells.
      • Arnold R
      • Humbert B
      • Werchau H
      • Gallati H
      • Konig W
      Interleukin-8, interleukin-6, and soluble tumor necrosis factor receptor type I release from a human pulmonary epithelial cell line (A549) exposed to respiratory syncytial virus.
      • Becker S
      • Koren HS
      • Henke DC
      Interleukin-8 expression in normal nasal epithelium and its modulation by infection with respiratory syncytial virus and cytokines tumor necrosis factor, interleukin-1, and interleukin-6.
      • Choi A
      • Jocoby D
      Influenza virus A infection induced interleukin-8 gene expression in human air way epithelial cells.
      • Saito T
      • Deskin R
      • Casola A
      • Haeberle H
      • Olzewska B
      • Alam R
      • Ogra P
      • Garofalo R
      Respiratory syncytial virus induces the selective release of RANTES by upper air way epithelial cells.
      Very little information, however, is available concerning epithelial cytokine secretion in response to viral infections in the gut. In the present study, we have investigated the production of chemokines during rotavirus infection of cultured human intestinal epithelial cell lines to define the possible contribution of the intestinal epithelium to the immune response during rotavirus infection. The panel of chemokines examined in this study are representative of the CXC and CC families, and their expression in intestinal epithelial cells has been shown to be increased by various infectious and inflammatory stimuli.
      • Eckmann L
      • Jung HC
      • Schurer-Maly C
      • Panja A
      • Morzycka-Wroblewska E
      • Kagnoff MF
      Differential cytokine expression by human intestinal epithelial cell lines: regulated expression of interleukin 8.
      • Eckmann L
      • Kagnoff MF
      • Fierer J
      Epithelial cells secrete the chemokine interleukin-8 in response to bacterial entry.
      • Jung HC
      • Eckmann L
      • Yang S-K
      • Panja A
      • Fierer J
      • Morzycka-Wroblewska E
      • Kagnoff MF
      A distinct array of proinflammatory cytokines is expressed in human colon epithelial cells in response to bacterial invasion.
      • Rasmussen S
      • Eckmann L
      • Quayle A
      • Shen L
      • Zhang Y
      • Anderson D
      • Fierer J
      • Stephens R
      • Kagnoff M
      Secretion of proinflammatory cytokines by epithelial cells in response to chlamydia infection suggests a central role of epithelial cells in chlamydial pathogenesis.
      • Yang S-K
      • Eckmann L
      • Panja A
      • Kagnoff MF
      Differential and regulated expression of C-X-C, C-C, and C-chemokines by human epithelial cells.

      Materials and methods

       Intestinal epithelial cell lines

      HT29 and Caco-2 cells were obtained from the American Type Culture Collection (Rockville, MD). Both cell lines derive from moderately differentiated colon carcinomas; HT29 cells, grown in the presence of glucose, show an undifferentiated phenotype, whereas Caco-2 cells spontaneously undergo functional enterocytic differentiation, expressing the highest levels of alkaline phosphatase and sucrase-isomaltase activity between 2 and 3 weeks after achieving confluence.
      • Fogh J
      • Orfeo T
      One hundred and twenty seven human tumor cell lines producing tumors in nude mice.
      • Pinto M
      • Robine-leon S
      • Appay MD
      • Kedinger M
      • Triadou N
      • Dussaulx E
      • Lacroix B
      • Simon-Assmann P
      • Haffen K
      • Fogh J
      • Zweibaum A
      Enterocyte-like differentiation and polarization of the human colon carcinoma cell line Caco-2 in culture.
      • Zweilbaum E
      • Laburtha M
      • Grasset E
      • Lauvard D
      Use of cultured cell lines in studies of intestinal cell differentiation and function.
      For a subset of experiments, we used HT29/19A cells (a generous gift of Dr. Andrew Morris), a clone derived by sodium butyrate treatment of HT29 cells, which exhibit features of differentiated small intestinal enterocytes independent of the presence of glucose.
      • Augeron C
      • Laboisse C
      Emergence of permanently differentiated cell clones in a human colonic cancer cell line in culture after treatment with sodium butyrate.
      Cells were grown in Dulbecco's modified Eagle medium supplemented with 10% fetal bovine serum, 1% nonessential amino acids, 2 mmol/L glutamine, 1 mmol/L sodium pyruvate, 50 IU/mL penicillin, and 50 μg/mL streptomycin, in 5% CO2 at 37°C. All tissue culture reagents were purchased from GIBCO BRL (Gaithersburg, MD). Cells were grown in T25 flasks for all the described experiments with the exception of viral dose-response studies, when cells were grown in 24-well plates.

       Viral preparations

      The simian strain of rotavirus SA114F was grown in MA104 cells, as described previously, and purified by centrifugation on a discontinuous sucrose gradient.
      • Estes M
      • Graham D
      • Gerba C
      • Smith E
      Simian rotavirus SA11 replication in cell culture.
      The titer of purified virus was determined by plaque assay.
      • Smith EM
      • Estes MK
      • Graham DY
      • Gerba CP
      A plaque assay for the simian rotavirus SA11.
      Virus-like particles (VLPs) containing the rotavirus major structural proteins, VP2, VP4, VP6, and VP7, were prepared using the baculovirus expression system, as described previously, with an additional purification through a 15%–45% sucrose gradient in a SW41 rotor (Beckman, Palo Alto, CA) at 35,000 rpm for 40 minutes at 4°C.
      • Crawford S
      • Labbe M
      • Cohen J
      • Burroughs M
      • Zhou Y
      • Estes M
      Characterization of virus-like particles produced by the expression of rotavirus capsid proteins in insect cells.
      Rotavirus was inactivated by treatment with 4'-aminomethyl-4,5',8-trimethylpsoralen hydrochloride (40 μg/mL; Lee Bio Molecular Research Laboratories Inc., San Diego, CA), followed by exposure to UV light (366 nm) for 40 minutes on ice.
      • Groene W
      • Shaw R
      Psoralen preparation of antigenically intact noninfectious rotavirus particles.
      This rotavirus preparation was plaque assayed to verify the inhibition of replication both after the initial psoralen/UV treatment as well as after one passage in MA104 cells. Virus-free media was prepared by ultracentrifugation of supernatants of HT29 cells infected with rotavirus for 24 hours, at 20,000g for 1 hour at 4°C. Viral preparations were tested for the presence of endotoxin using the Limulus amebocyte lysate assay (Associate of Cape Cod, Inc., Woods Hole, MA). The sensitivity of the test is 0.06 EU/mL.

       Virus infection

      Cell monolayers, grown to 90% confluence in T25 flasks, were infected with rotavirus (activated with 10 μg/mL trypsin at 37°C for 30 minutes) at different multiplicity of infection (MOI) ranging from 0.1 to 10. Before infection, cells were washed three times with serum-free medium, and the desired amount of purified virus, diluted in 1 mL volume of serum-free medium, was added to the cells. An equivalent amount of trypsin-treated 20% sucrose solution, diluted in 1 mL of the same medium, was added to the mock-infected (control) cells. The monolayers were incubated for 1 hour at 37°C in 5% CO2 followed by removal of the virus-containing medium. Cells were washed three times, 5 mL of serum-free medium was added to the flasks, and the infection was continued for the indicated times in a 37°C incubator. Viral infection was documented and monitored by light-microscopic observation of a cytopathic effect and by indirect immunofluorescence. In a subset of experiments, HT29 and Caco-2 cells were also stimulated with tumor necrosis factor (TNF)-α (20 ng/mL) and IL-1β (10 ng/mL; R&D Systems, Minneapolis, MN). At designated times, supernatants were removed, centrifuged at 200g, and stored at −70°C until assayed. In specific experiments, saturating concentrations of neutralizing antibodies
      • Patel JA
      • Kunimoto M
      • Sim TC
      • Garofalo R
      • Eliott T
      • Baron S
      • Ruuskanen O
      • Chonmaitree T
      • Ogra PL
      • Schmalstieg F
      Interleukin-1α mediates the enhanced expression of intercellular adhesion molecule-1 in pulmonary epithelial cells infected with respiratory syncytial virus.
      to IL-1α, IL-1β (10 μg/mL; R&D Systems), and TNF-α (20 μg/mL; Biosource, Camarillo, CA) were added 1 hour before and during the viral infection.

       Immunofluorescence

      HT29 cells grown in eight-well chamber slides (Costar, Cambridge, MA) were infected with rotavirus, at a MOI of 1, for 24 hours. Cells were washed in phosphate-buffered saline (PBS), fixed with 4% paraformaldehyde in PBS for 20 minutes, washed again with PBS, and incubated with 50 mmol/L NH4Cl for 10 minutes. The cells were then permeabilized with 0.2% (vol/vol) Triton X-100 for 15 minutes and washed with 2% bovine serum albumin/PBS. The cells were incubated with the primary antibody (diluted 1/200, mouse polyclonal antiserum raised against SA114F) for 1 hour at room temperature. The slides were then washed with cold 0.05% Tween 20/PBS three times and incubated with the secondary antibody (fluorescein isothiocyanate–conjugated goat anti-mouse F(ab')2 antibody; Tago Inc., Camarillo, CA), diluted 1/200, for 1 hour. After washing with cold 0.05% Tween 20/PBS, cells were counterstained with Evans blue and examined with a fluorescence microscope (Nikon OPTIPHOT; Melville, NY) equipped with a photomicrographic attachment (HFX-DX; Nikon).

       Cytokine assays

      Cytokine concentrations were determined by enzyme-linked immunosorbent assay (ELISA). Assays of GRO-α, MCP-1, MIP-1α, IL-1α, and TNF-α were performed using ELISA kits (Quantikine; R&D Systems), according to the manufacturer's protocol. Sensitivity was between 6 and 16 pg/mL. The IL-8 ELISA was performed using an optimal concentration of a mouse monoclonal anti-human IL-8 antibody (5 μg/mL; Biosource) as the capturing antibody, a rabbit polyclonal anti-human IL-8 antibody (2.5 μg/mL; Endogen, Cambridge, MA ) as the detecting antibody, and a biotinylated donkey anti-rabbit (1:20,000; Pierce Chemical, Rockford, IL) as a second step antibody. Streptavidin–horseradish peroxidase conjugate (1:5000; Zymed Laboratories, San Francisco, CA) was added for 30 minutes. O-Phenylenediamine dihydrochloride (Sigma Chemical Co., St. Louis, MO) was used as a substrate, and the absorbance was read at 492 nm on an automated ELISA reader (Titertek Multiskan MCC/340; ICN, Costa Mesa, CA). The sensitivity was 30 pg/mL. RANTES was also analyzed by a similar ELISA using monoclonal antibody anti-human RANTES (2 μg/mL; R&D Systems) and biotinylated polyclonal goat anti-human RANTES antibody (2 μg/mL; R&D Systems). IL-8 and RANTES were also measured in random samples by commercial ELISA kits (R&D Systems). Excellent correlation was found between the concentrations measured by the ELISA techniques described above and those measured by commercial kits.

       RNA extraction and polymerase chain reaction amplification

      RNA was extracted using a modified acid guanidinium thiocyanate-phenol-chloroform method.
      • Chomczynski P
      • Sacchi N
      Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction.
      Complementary DNA (cDNA) and subsequent polymerase chain reaction (PCR) amplification was performed using Gene RNA PCR kit components (Perkin Elmer; Roche Molecular System Inc., Branchburg, NJ). Briefly, 2 μg of total RNA was incubated at 42°C for 30 minutes in 20 μL of reverse-transcription mixture consisting of 5 mmol/L MgCl2, 50 mmol/L Tris-HCl (pH 8.3), 1 mmol/L deoxyribonucleoside triphosphates, 1 U/μL RNase inhibitor, 2.5 U/μL MuLV reverse transcriptase, 2.5 μmol/L random hexamers. The products of RNA transcription were denatured by heating at 99°C for 5 minutes, and 50 μL of 2 mmol/L MgCl2, 50 mmol/L KCl, 10 mmol/L Tris-HCl (pH 8.3), 2.5 U of Ampli Taq DNA polymerase, and 25 pmol each of the 5' and 3' primers were added. The PCR reaction was carried out in a final volume of 100 μL in a DNA thermal cycler (Perkin Elmer) programmed as follows: denaturation cycle at 95°C for 45 seconds, annealing at 60°C for 45 seconds, and extension at 72°C for 2 minutes for a total of 33 cycles for IL-8, RANTES, and β-actin. For the GRO-α PCR reaction, annealing and extension were performed at 72°C for a total of 28 cycles. The optimal number of cycles for PCR was determined by adding fivefold serial dilutions of the cDNA to the PCR reactions, as previously described.
      • Saito T
      • Deskin R
      • Casola A
      • Haeberle H
      • Olzewska B
      • Alam R
      • Ogra P
      • Garofalo R
      Respiratory syncytial virus induces the selective release of RANTES by upper air way epithelial cells.
      • Garofalo R
      • Sabry M
      • Jamaluddin M
      • Yu R
      • Casola A
      • Ogra P
      • Brasier A
      Transcriptional activation of the interleukin-8 gene by respiratory syncytial virus infection in alveolar epithelial cells: nuclear translocation of the RelA transcription factor as a mechanism producing air way mucosal inflammation.
      Plasmids containing the GRO-α, IL-8, and RANTES cDNAs (generous gifts of Dr. S. Becker, University of North Carolina, and Drs. A. R. Brasier and R. Alam, University of Texas Medical Branch, respectively) were used as positive controls. Sequences of PCR primers used were the following: IL-8 sense, 5'ATGACTTCCAAGCTGGCCGTGGCT3', and antisense, 5'TCTCAGCCCTCTTCAAAAACTTCTC3'
      • Garofalo R
      • Sabry M
      • Jamaluddin M
      • Yu R
      • Casola A
      • Ogra P
      • Brasier A
      Transcriptional activation of the interleukin-8 gene by respiratory syncytial virus infection in alveolar epithelial cells: nuclear translocation of the RelA transcription factor as a mechanism producing air way mucosal inflammation.
      ; GRO-α sense, 5'TAGCCACACTCAAGAATGGGCGGAAAGCTT3', and antisense, 5'TGGCCATTTGCTTGGATCCGCCAGCCT3'
      • Becker S
      • Quay J
      • Koren H
      • Haskill J
      Constitutive and stimulated MCP-1, GRO alpha, beta, and gamma expression in human air way epithelium and bronchoalveolar macrophages.
      ; RANTES sense, 5'GCTGTCATCCTCATTGCTAC3', and antisense, 5'TCTCCATCCTAGCTCATCTC3'
      • Saito T
      • Deskin R
      • Casola A
      • Haeberle H
      • Olzewska B
      • Alam R
      • Ogra P
      • Garofalo R
      Respiratory syncytial virus induces the selective release of RANTES by upper air way epithelial cells.
      ; and β-actin sense, 5'ATCTGGCACCACACCTTCTACAATGAGCTGCG3', and antisense, 5'CGTCATACTCCTGCTTGCTGATCCACATCTGC3'.
      • Saito T
      • Deskin R
      • Casola A
      • Haeberle H
      • Olzewska B
      • Alam R
      • Ogra P
      • Garofalo R
      Respiratory syncytial virus induces the selective release of RANTES by upper air way epithelial cells.
      PCR products were resolved alongside 100–base pair (bp) DNA markers (GIBCO BRL) on a 6% polyacrylamide gel, stained with ethidium bromide, visualized under UV light, and photographed.

       Statistical analysis

      All experiments were performed in duplicate or triplicate with n values equal to the number of experiments. Chemokine concentrations were compared using analysis of variance for a two-factor experiment with repeated measures over time. All tests were assessed at the 0.05 or 0.01 levels of significance.

      Results

       CC and CXC chemokine production after rotavirus infection

      Confluent monolayers of HT29 cells were infected with rotavirus at an MOI of 1. Cytopathic effect (progressive cell rounding and cell detachment from the plastic surface by 48 hours after infection) and indirect immunofluorescence were used in these experiments to document and monitor viral infection (Figure 1).
      Figure thumbnail gr1a
      Fig. 1Immunofluorescence staining of rotavirus-infected HT29 cells. Cells were infected with rotavirus at MOI of 1 for 24 hours and stained with a mouse antiserum raised against SA11 strain as the primary antibody and a fluorescein isothiocyanate–conjugated goat anti-mouse F(ab')2 antibody as the secondary antibody. (A) Mock-infected control cells. (B) Rotavirus-infected cells.
      Figure thumbnail gr1b
      Fig. 1Immunofluorescence staining of rotavirus-infected HT29 cells. Cells were infected with rotavirus at MOI of 1 for 24 hours and stained with a mouse antiserum raised against SA11 strain as the primary antibody and a fluorescein isothiocyanate–conjugated goat anti-mouse F(ab')2 antibody as the secondary antibody. (A) Mock-infected control cells. (B) Rotavirus-infected cells.
      SA114F replication in HT29 cells was assessed by performing growth curve analysis (data not shown).
      The presence of immunoreactive chemokines in cell supernatants was determined by specific ELISA with the results summarized in Table 1. Mock-infected HT29 cells constitutively released small amounts of IL-8, GRO-α, and RANTES, whereas the production of MCP-1 and MIP-1α was almost undetectable. At 24 hours, HT29 cells infected with rotavirus showed an increased production of IL-8, GRO-α, and RANTES, with no changes of MCP-1 and MIP-1α levels. As the target cell of rotavirus infection is the mature enterocyte of the villi, we performed the same experiments in HT29/19A cells, which show features of differentiated enterocytes, and in Caco-2 cells at varying degrees of confluence. Although both types of HT29 cells showed similar basal levels of immunoreactive IL-8, levels of IL-8 were significantly greater in supernatants of HT29/19A cells than in HT29 cells after rotavirus infection (Table 1). Basal levels of RANTES differed between the two types of HT29 cells with lower levels in HT29/19A supernatants. After rotavirus infection, RANTES levels were higher in infected HT29/19A supernatants compared with levels in HT29 supernatants. Levels of GRO-α were not different between HT29/19A and HT29 both at baseline and after viral infection. Only a small increase in IL-8 was observed in Caco-2 cells infected with rotavirus at 10 days after confluence, whereas other chemokine levels were unchanged from uninfected control cells. No differences in chemokine levels were measured in Caco-2 cells infected at various degrees of confluence (data not shown).
      Table 1Chemokine production by intestinal epithelial cell lines infected with rotavirus
      CelllinesIL-8 (pg/mL)GRO-α (pg/mL)RANTES (pg/mL)MIP-1α (pg/mL)MCP-1 (pg/mL)
      HT29
       Control164 ± 20130 ± 2185 ± 319 ± 37 ± 1
       Infected1993 ± 128a626 ± 53a208 ± 12a22 ± 48 ± 1
      HT29/19A
       Control299 ± 90156 ± 1720 ± 1b19 ± 58 ± 1
       Infected3268 ± 66a,b768 ± 38a303 ± 40a,b20 ± 59 ± 1
      Caco-2
       Control163 ± 19560 ± 1245 ± 316 ± 2280 ± 10
       Infected380 ± 23a600 ± 1254 ± 221 ± 3284 ± 12
      aP < 0.01 vs. uninfected. bP < 0.01 vs. HT29.
      NOTE. Chemokine concentrations measured in culture supernatants after 24-hour infection with rotavirus (MOI of 1) or mock-infected control cells are expressed as mean ± SEM (n = 2–7).
      To compare the pattern and the magnitude of chemokine induction by rotavirus infection to that induced by known stimuli of chemokine expression, HT29 and Caco-2 cells were stimulated with TNF-α or IL-1β. As illustrated in Figure 2, expression of IL-8 and GRO-α was increased by rotavirus as well as cytokines, whereas RANTES was stimulated by viral infection only and MCP-1 by cytokine treatment only.
      Figure thumbnail gr2
      Fig. 2Comparison of chemokine release by intestinal epithelial cells after cytokine stimulation and rotavirus infection. (A) Caco-2 and (B) HT29 cells were infected with rotavirus (MOI of 1) or treated with TNF-α (20 ng/mL, ▩) or IL-1β (10 ng/mL, ▨ ). 2, Control; ■, SA11. Cell supernatants were harvested 24 hours later, and chemokine levels were assayed by ELISA. Values are expressed as fold induction compared with basal levels of mock-infected control cells or cells treated with vehicle only (n = 3).
      No stimulation of immunoreactive chemokines was found when Caco-2 cells were treated with TNF-α, consistent with the findings in previously published studies.
      • Eckmann L
      • Jung HC
      • Schurer-Maly C
      • Panja A
      • Morzycka-Wroblewska E
      • Kagnoff MF
      Differential cytokine expression by human intestinal epithelial cell lines: regulated expression of interleukin 8.
      • Yang S-K
      • Eckmann L
      • Panja A
      • Kagnoff MF
      Differential and regulated expression of C-X-C, C-C, and C-chemokines by human epithelial cells.
      To examine the dose effect of rotavirus on chemokine production, cells were infected with different MOI, ranging from 0.1 to 10 plaque-forming units per cell. Infection with rotavirus at a MOI as low as 0.1 was able to induce IL-8 and GRO-α secretion; cells infected with a MOI of 10 showed a 6-fold, 12-fold, and 25-fold increase of RANTES, GRO-α, and IL-8 production, respectively, compared with uninfected cells (Figure 3).
      Figure thumbnail gr3
      Fig. 3Dose-dependent release of chemokines after rotavirus infection. HT29 cells were infected with rotavirus at different MOI, ranging from 0.1 to 10. Cell supernatants were harvested at 24 hours after infection, and chemokine levels were assayed by ELISA. Values are expressed as fold induction compared with basal levels of mock-infected control cells (n = 3).
      MCP-1 and MIP-1α levels were not altered in any of the cell lines tested, even at the highest MOI of infection.

       Role of other factors in chemokine induction by rotavirus infection

      Because lipopolysaccharide (LPS) has been shown to induce cytokine production in epithelial cells (although intestinal epithelial cells are much less sensitive to LPS than other mucosal epithelial cells), viral preparations were tested for the presence of endotoxin. Negligible levels of LPS (range, 0.0008–0.004 EU/μg of viral protein) were found in random samples of different viral preparations.
      Epithelial cells are able to produce IL-1α, IL-1β, and TNF-α, cytokines known to be potent inducers of chemokine secretion.
      • Miller MD
      • Krangel MS
      Biology and biochemistry of the chemokines: a family of chemotactic and inflammatory cytokines.
      To test the possibility that chemokine production after rotavirus infection was mediated by the release of one of these cytokines, IL-1α and TNF-α were assayed by ELISA in supernatants from HT29 cells after viral infection. We found negligible levels of both cytokines (data not shown). Furthermore, we treated cells with antibodies against IL-1α, IL-1β, and TNF-α at concentrations previously shown to be effective in blocking cytokine-mediated events after viral infection.
      • Patel JA
      • Kunimoto M
      • Sim TC
      • Garofalo R
      • Eliott T
      • Baron S
      • Ruuskanen O
      • Chonmaitree T
      • Ogra PL
      • Schmalstieg F
      Interleukin-1α mediates the enhanced expression of intercellular adhesion molecule-1 in pulmonary epithelial cells infected with respiratory syncytial virus.
      The addition of the antibodies, alone or in combination, either before or during viral infection, did not alter levels of virus-induced chemokine production (data not shown). We also tested the possibility that secondary soluble mediators induced by rotavirus infection could be responsible for chemokine induction. However, when virus-free medium from rotavirus-infected cultures was added to uninfected cells as 50% of the total cell culture volume, no increase in immunoreactive chemokine production was measured in cell supernatants harvested 24 hours later (data not shown).

       Time course of chemokine secretion and chemokine messenger RNA expression

      To characterize the kinetics of chemokine production, secretion of IL-8, GRO-α, and RANTES was determined in supernatants of rotavirus-infected and mock-infected cells starting at 2 hours up to 48 hours after infection, a time when infected cells start to lose viability. Low levels of IL-8 and GRO-α were measured at 6 hours after infection, followed by a rapid increase between 12 and 24 hours after infection with a more gradual elevation up to 48 hours after infection (Figure 4).
      Figure thumbnail gr4
      Fig. 4Kinetics of chemokine secretion after rotavirus infection. Confluent monolayers of HT29 cells were infected with rotavirus at a MOI of 1. At the indicated times, cell supernatants were harvested and assayed for (A) IL-8, (B) GRO-α, and (C) RANTES by ELISA. 2, Mock-infected control cells; ■, rotavirus-infected cells. Results are expressed as means ± SD (n = 3–5). *P < 0.05, **P < 0.01 compared with mock infected.
      Increased RANTES secretion was also observed at 6 hours after infection, with peak values between 12 and 24 hours after infection and a progressive decrease by 48 hours (Figure 4).
      The increase of chemokine protein secretion was paralleled by the increase in IL-8, GRO-α, and RANTES messenger RNA (mRNA) levels, suggesting that chemokine induction was mediated through enhanced mRNA production and/or mRNA stabilization (Figure 5).
      Figure thumbnail gr5
      Fig. 5Kinetics of change in chemokine mRNA abundance in response to rotavirus infection by reverse-transcription PCR. Total RNA was extracted from HT29 cells infected with rotavirus (MOI of 1) for the indicated times. β-Actin is included as an internal control. Lane 1, molecular weight markers; lane 2, positive control (cDNA); lane 3, mock-infected HT29 cells; lane 4, 6-hour infection; lane 5, 12-hour infection; lane 6, 24-hour infection; lane 7, 48-hour infection.

       Effect of viral replication and VLPs on chemokine production

      To investigate whether viral attachment to the cells could be a sufficient stimulus to induce chemokine secretion, we used VLPs. VLPs are particles derived by coexpression of different combinations of the rotavirus major structural proteins, which results in the formation of stable VLPs.
      • Crawford S
      • Labbe M
      • Cohen J
      • Burroughs M
      • Zhou Y
      • Estes M
      Characterization of virus-like particles produced by the expression of rotavirus capsid proteins in insect cells.
      The VLPs used in our experiments were triple-layered VLPs containing the major outer and inner capsid proteins VP2, VP4, VP6, and VP7. These types of VLPs, containing VP4, are able to bind to epithelial cells.
      • Crawford S
      • Labbe M
      • Cohen J
      • Burroughs M
      • Zhou Y
      • Estes M
      Characterization of virus-like particles produced by the expression of rotavirus capsid proteins in insect cells.
      VLPs, normalized to 10 plaque-forming units per cell of intact rotavirus by protein concentration (Bio-Rad, Hercules, CA), were added to HT29 cells, and chemokine secretion was assessed 24 and 48 hours later. There was no difference in the production of any of the chemokines tested between control and treated cells at either time (shown in Figure 6 for IL-8 at 24 hours).
      Figure thumbnail gr6
      Fig. 6Effect of viral inactivation and VLPs on IL-8 production. HT29 cells were infected with live rotavirus (SA11) or psoralen/UV-treated virus (Psor./UV), both at an MOI of 1, or treated with VLPs. Cell supernatants were harvested 24 hours after infection, and IL-8 secretion was assayed by ELISA. Results are expressed as means ± SD (n = 3). *P < 0.01 compared with mock-infected control cells.
      To determine whether chemokine induction was dependent on viral replication, we used psoralen-inactivated rotavirus to infect HT29 cells. UV exposure of psoralen-treated rotavirus results in RNA cross-linking and inhibition of viral replication.
      • Groene W
      • Shaw R
      Psoralen preparation of antigenically intact noninfectious rotavirus particles.
      Identical amounts of untreated and psoralen/UV-inactivated rotavirus, corresponding to 1 plaque-forming unit per cell, were added to HT29 cells, and cell supernatants were collected 24 hours after inoculation. In contrast to live rotavirus, psoralen-inactivated rotavirus was not able to induce chemokine production (shown in Figure 6 for IL-8), indicating that viral replication was necessary for the induction of the chemokines tested.

      Discussion

      Rotavirus is the major viral pathogen responsible for pediatric gastroenteritis. It infects and replicates in the mature enterocytes of the small intestine, causing flattening of epithelial cells, blunting of villi, increased crypt depth, and increased inflammatory cells in the lamina propria.
      • Greenberg H
      • Clark H
      • Offit P
      Rotavirus pathology and pathophysiology.
      Although it is well recognized that infected epithelial cells are the major target of activated immune cells, there is growing evidence that epithelial cells can also function as an early warning system to the immune cells in the underlying mucosa. Recently, gut epithelial cells have been shown to produce chemokines after bacterial and protozoal infections as well as cytokine stimulation.
      • Eckmann L
      • Jung HC
      • Schurer-Maly C
      • Panja A
      • Morzycka-Wroblewska E
      • Kagnoff MF
      Differential cytokine expression by human intestinal epithelial cell lines: regulated expression of interleukin 8.
      • Eckmann L
      • Kagnoff MF
      • Fierer J
      Epithelial cells secrete the chemokine interleukin-8 in response to bacterial entry.
      • Crowe SE
      • Alvarez L
      • Dytoc M
      • Hunt RH
      • Muller M
      • Sherman PM
      • Patel J
      • Jin Y
      • Ernst PB
      Expression of interleukin-8 and CD54 by human gastric epithelium after Helicobacter pylori infection in vitro.
      • Jung HC
      • Eckmann L
      • Yang S-K
      • Panja A
      • Fierer J
      • Morzycka-Wroblewska E
      • Kagnoff MF
      A distinct array of proinflammatory cytokines is expressed in human colon epithelial cells in response to bacterial invasion.
      • Rasmussen S
      • Eckmann L
      • Quayle A
      • Shen L
      • Zhang Y
      • Anderson D
      • Fierer J
      • Stephens R
      • Kagnoff M
      Secretion of proinflammatory cytokines by epithelial cells in response to chlamydia infection suggests a central role of epithelial cells in chlamydial pathogenesis.
      Chemokines are a novel class of small cytokines that can recruit and activate different populations of leukocytes
      • Miller MD
      • Krangel MS
      Biology and biochemistry of the chemokines: a family of chemotactic and inflammatory cytokines.
      • Strieter R
      • Koch A
      • Antony V
      • Fick R
      • Standiford T
      • Kunkel S
      The immunopathology of chemotactic cytokines.
      and therefore have a potential role as important mediators of immune/inflammatory responses. In this study, we investigated the repertoire of CXC and CC chemokines produced by two cultured intestinal epithelial cell lines, HT29 and Caco-2, after rotavirus infection. We show that rotavirus infection induces increased secretion of IL-8, GRO-α, and RANTES in HT29 cells in a dose- and time-dependent manner that requires viral replication.
      Respiratory viruses are known to induce chemokine secretion in infected airway epithelial cells,
      • Arnold R
      • Humbert B
      • Werchau H
      • Gallati H
      • Konig W
      Interleukin-8, interleukin-6, and soluble tumor necrosis factor receptor type I release from a human pulmonary epithelial cell line (A549) exposed to respiratory syncytial virus.
      • Becker S
      • Koren HS
      • Henke DC
      Interleukin-8 expression in normal nasal epithelium and its modulation by infection with respiratory syncytial virus and cytokines tumor necrosis factor, interleukin-1, and interleukin-6.
      • Choi A
      • Jocoby D
      Influenza virus A infection induced interleukin-8 gene expression in human air way epithelial cells.
      but relatively little is known about the intestinal epithelial chemokine response to viral infections. A recent report by Sheth et al.
      • Sheth R
      • Anderson J
      • Sato T
      • Oh B
      • Hempson SJ
      • Rollo E
      • Mackow ER
      • Shaw RD
      Rotavirus stimulates IL-8 secretion from cultured epithelial cells.
      has shown enhanced IL-8 production by cultured intestinal epithelial cells infected with rotavirus. We have found that rotavirus infection induces an increased mRNA expression and protein secretion of IL-8, GRO-α, and RANTES in HT29 cells and a small increase of IL-8 secretion in Caco-2 cells. This is the first report of RANTES gene up-regulation in intestinal epithelial cells after a viral infection. We have recently shown that respiratory syncytial virus can induce the production of RANTES in infected airway epithelial cells.
      • Saito T
      • Deskin R
      • Casola A
      • Haeberle H
      • Olzewska B
      • Alam R
      • Ogra P
      • Garofalo R
      Respiratory syncytial virus induces the selective release of RANTES by upper air way epithelial cells.
      The time course of chemokine production in HT29 cells shows that IL-8 and GRO-α levels increase rapidly between 12 and 24 hours after infection, with slower elevation up to 48 hours, whereas increased RANTES secretion is observed at 6 hours after infection, with peak values between 12 and 24 hours after infection. There is a relative delay of CXC chemokine induction after rotavirus infection compared with cytokine stimulation or bacterial infection of intestinal epithelial cells.
      • Eckmann L
      • Jung HC
      • Schurer-Maly C
      • Panja A
      • Morzycka-Wroblewska E
      • Kagnoff MF
      Differential cytokine expression by human intestinal epithelial cell lines: regulated expression of interleukin 8.
      • Jung HC
      • Eckmann L
      • Yang S-K
      • Panja A
      • Fierer J
      • Morzycka-Wroblewska E
      • Kagnoff MF
      A distinct array of proinflammatory cytokines is expressed in human colon epithelial cells in response to bacterial invasion.
      • Yang S-K
      • Eckmann L
      • Panja A
      • Kagnoff MF
      Differential and regulated expression of C-X-C, C-C, and C-chemokines by human epithelial cells.
      Recent reports show that RANTES is also up-regulated after bacterial infection and cytokine stimulation but that the kinetics of this response is delayed compared with other chemokines, including IL-8 and GRO-α.
      • Yang S-K
      • Eckmann L
      • Panja A
      • Kagnoff MF
      Differential and regulated expression of C-X-C, C-C, and C-chemokines by human epithelial cells.
      These findings are consistent with our results demonstrating the absence of cytokine-induced stimulation of RANTES protein at 24 hours. The results of our study suggest that the mechanisms by which viruses induce chemokine secretion differ from those involved in bacterial or cytokine stimulation of intestinal epithelial cells. Moreover, the different kinetics of RANTES induction compared with IL-8 and GRO-α may also indicate that distinct cytokine signaling pathways are triggered during rotavirus infection.
      The two intestinal cell lines used in this study, HT29 and Caco-2, show morphological and biochemical features of small intestine enterocytes,
      • Zweilbaum E
      • Laburtha M
      • Grasset E
      • Lauvard D
      Use of cultured cell lines in studies of intestinal cell differentiation and function.
      the target cells of rotavirus infection. HT29 cells are relatively undifferentiated when grown in the presence of glucose but resemble mature enterocytes when grown in glucose-free medium or when treated with sodium butyrate, like the HT29 clone 19A used in our experiments
      • Augeron C
      • Laboisse C
      Emergence of permanently differentiated cell clones in a human colonic cancer cell line in culture after treatment with sodium butyrate.
      ; Caco-2 cells undergo a spontaneous enterocytic differentiation after confluence.
      • Pinto M
      • Robine-leon S
      • Appay MD
      • Kedinger M
      • Triadou N
      • Dussaulx E
      • Lacroix B
      • Simon-Assmann P
      • Haffen K
      • Fogh J
      • Zweibaum A
      Enterocyte-like differentiation and polarization of the human colon carcinoma cell line Caco-2 in culture.
      Although both cell lines are derived from human colon cancer, they have been widely used to evaluate epithelial chemokine responses to a variety of different stimuli
      • Eckmann L
      • Jung HC
      • Schurer-Maly C
      • Panja A
      • Morzycka-Wroblewska E
      • Kagnoff MF
      Differential cytokine expression by human intestinal epithelial cell lines: regulated expression of interleukin 8.
      • Jung HC
      • Eckmann L
      • Yang S-K
      • Panja A
      • Fierer J
      • Morzycka-Wroblewska E
      • Kagnoff MF
      A distinct array of proinflammatory cytokines is expressed in human colon epithelial cells in response to bacterial invasion.
      • Rasmussen S
      • Eckmann L
      • Quayle A
      • Shen L
      • Zhang Y
      • Anderson D
      • Fierer J
      • Stephens R
      • Kagnoff M
      Secretion of proinflammatory cytokines by epithelial cells in response to chlamydia infection suggests a central role of epithelial cells in chlamydial pathogenesis.
      and are equally susceptible to rotavirus infection.
      • Superti F
      • Tinari A
      • Baldassarri L
      • Donelli G
      HT29 cells: a new substrate for rotavirus growth.
      • Kitamoto N
      • Ramig RF
      • Matson DO
      • Estes MK
      Comparative growth of different rotavirus strains in differentiated cells (MA104, HepG2, and CaCo-2).
      HT29 cells exhibit a significant increase in both CXC and CC chemokines after rotavirus infection. This response is more marked in the HT29/19A cells, a finding that may be explained by the fact that more differentiated (villus) enterocytes are the natural target of rotavirus infection. In contrast, the chemokine response of Caco-2 cells to rotavirus, regardless of the stage of confluence, is limited. These findings can be compared with the relative lack of response of Caco-2 cells to other stimuli, such as TNF-α, LPS, and interferon gamma, that are able to induce chemokine production in other intestinal epithelial cell lines.
      • Eckmann L
      • Jung HC
      • Schurer-Maly C
      • Panja A
      • Morzycka-Wroblewska E
      • Kagnoff MF
      Differential cytokine expression by human intestinal epithelial cell lines: regulated expression of interleukin 8.
      • Yang S-K
      • Eckmann L
      • Panja A
      • Kagnoff MF
      Differential and regulated expression of C-X-C, C-C, and C-chemokines by human epithelial cells.
      Viral attachment alone is not sufficient to induce chemokine production, as indicated by the lack of response to the VLPs. Chemokine secretion seems to be dependent on viral replication, as shown by the inability of psoralen-inactivated rotavirus to induce chemokine production. Furthermore, chemokine secretion in infected cells does not seem to be mediated by a secondary paracrine factor because the supernatant of virus-infected cells has no effect on chemokine secretion; this suggests that the production and accumulation of viral products could be important for the induction of epithelial chemokine response. Inactivated rotavirus was recently shown by Sheth et al.
      • Sheth R
      • Anderson J
      • Sato T
      • Oh B
      • Hempson SJ
      • Rollo E
      • Mackow ER
      • Shaw RD
      Rotavirus stimulates IL-8 secretion from cultured epithelial cells.
      to induce IL-8 secretion. Although our findings are generally in keeping with those reported in that study, we did not observe increased IL-8 production after exposure of intestinal epithelial cells to psoralen/UV-inactivated rotavirus. The different strain of rotavirus used in their experiments, differences in viral preparation, and levels of inactivation may account for the discrepancy in the results. However, our results are similar to those observed in studies examining respiratory viruses such as respiratory syncytial virus and rhinovirus. In those studies,
      • Garofalo R
      • Sabry M
      • Jamaluddin M
      • Yu R
      • Casola A
      • Ogra P
      • Brasier A
      Transcriptional activation of the interleukin-8 gene by respiratory syncytial virus infection in alveolar epithelial cells: nuclear translocation of the RelA transcription factor as a mechanism producing air way mucosal inflammation.
      • Zhu Z
      • Tang W
      • Ray A
      • Wu Y
      • Einarsson O
      • Landry ML
      • Gwaltney J
      • Elias JA
      Rhinovirus stimulation of interleukin-6 in vivo and in vitro: evidence for nuclear factor κB—dependent transcriptional activation.
      live virus, but not inactivated viral preparations, elicited chemokine responses in airway epithelial cells, suggesting that replicating virus is necessary for chemokine induction in epithelial cells.
      The finding of an increased secretion of a subset of chemokines by infected HT29 cells suggests that intestinal epithelial cells could be involved in the mucosal immune response to rotavirus. Several recent studies show that CD8+ T cells are important in the immune response to rotavirus,
      • Franco M
      • Greenberg H
      Role of B cells and cytotoxic T lymphocytes in clearance of an immunity to rotavirus infection in mice.
      • McNeal M
      • Barone K
      • Rae M
      • Ward R
      Effector functions of antibody and CD8+ cells in resolution of rotavirus infection and protection against reinfection in mice.
      • Franco MA
      • Tin C
      • Greenberg HB
      CD8+ T cells can mediate almost complete short-term and partial long-term immunity to rotavirus in mice.
      and it is likely that chemokines expressed by epithelial cells during rotavirus infection play a role in these events. IL-8 and RANTES have recently been found to be the most potent chemoattractants for intestinal intraepithelial lymphocytes, a population of cells that are predominantly CD8+ T lymphocytes, with very low concentrations, in the range of 0.1–1 ng/mL, capable of inducing intraepithelial lymphocyte migration.
      • Ebert E
      IL-8, RANTES, and GRO are chemotactic for intraepithelial lymphocytes (IEL).
      Chemokines expressed during rotavirus infection may be involved in the recruitment of other inflammatory cells, although the mucosal inflammation associated with rotavirus infection is predominantly mononuclear and less intense than the inflammatory infiltrate that accompanies bacterial infections of the intestine.
      • Davidson GP
      • Barnes GL
      Structural and functional abnormalities of the small intestine in infants and young children with rotavirus enteritis.
      It is worth noting that neutrophils can be found in intestinal mucosal biopsy specimens from some cases of human rotavirus infection (R. Bishop, personal communication, January 1997), and a neutrophilic infiltrate has been described in several animal models of rotavirus infection.
      • Yason C
      • Summers B
      • Schat K
      Pathogenesis of rotavirus infection in various age groups of chickens and turkeys: pathology.
      • Snodgrass D
      • Angus K
      • Gray E
      Rotavirus infection in lambs: pathogenesis and pathology.
      An interesting observation with relevance to rotavirus infection and the findings in our study is the prolific monocyte and T lymphocyte infiltrate without neutrophils reported in an allergic contact dermatitis model in which IL-8 is strongly up-regulated.
      • Griffiths C
      • Barker J
      • Kunkel S
      • Nickoloff B
      Modulation of leukocyte adhesion molecules, a T-cell chemotaxin (IL-8) and a regulatory cytokine (TNF-α) in allergic contact dermatitis (rhus dermatitis).
      It is clear that the net migration of leukocytes into tissues is governed by a delicate interplay between factors that positively and negatively regulate the expression of chemokines and other chemoattractants, as well as the various classes of cellular adhesion molecules. Studies in native intestinal tissues are needed to examine the various factors that regulate the inflammatory response to rotavirus infection.
      In summary, we have shown that rotavirus infection can induce secretion of a subset of chemokines in cultured intestinal epithelial cells. It will be important to extend these in vitro observations to an in vivo model. Our findings support the hypothesis that production of chemokines by intestinal epithelial cells may be an important event for the initiation and modulation of the mucosal immune response to rotavirus infection; additional studies are needed to evaluate the role of enterocyte chemokine expression in the immune response to rotavirus infection.

      References

        • Bishop R
        • Davidson G
        • Holmes I
        • Ruck B
        Virus particles in the epithelial cells of duodenal mucosa from children with acute non-bacterial gastroenteritis.
        Lancet. 1973; 2: 1281-1293
        • Flewett T
        • Bryden A
        • Davies H
        Virus particle in gastroenteritis (abstr).
        Lancet. 1973; 2: 1497
        • Greenberg H
        • Clark H
        • Offit P
        Rotavirus pathology and pathophysiology.
        Curr Top Microbiol Immunol. 1994; 185: 255-283
        • Eckmann L
        • Jung HC
        • Schurer-Maly C
        • Panja A
        • Morzycka-Wroblewska E
        • Kagnoff MF
        Differential cytokine expression by human intestinal epithelial cell lines: regulated expression of interleukin 8.
        Gastroenterology. 1993; 105: 1689-1697
        • Miller MD
        • Krangel MS
        Biology and biochemistry of the chemokines: a family of chemotactic and inflammatory cytokines.
        CRC Crit Rev Immunol. 1992; 12: 17-46
        • Strieter R
        • Koch A
        • Antony V
        • Fick R
        • Standiford T
        • Kunkel S
        The immunopathology of chemotactic cytokines.
        J Lab Clin Med. 1994; 123: 183-197
        • Bacon K
        • Scall T
        Chemokines as mediators of allergic inflammation.
        Int Arch Allergy Immunol. 1996; 109: 97-109
        • Geiser T
        • Dewald B
        • Ehrengruber MU
        • Clark-Lewis I
        • Baggiolini M
        The interleukin-8-related chemotactic cytokines GROα, GROβ, and GROγ activate human neutrophil and basophil leukocytes.
        J Biol Chem. 1993; 268: 15419-15424
        • Larsen C
        • Anderson A
        • Apella E
        • Oppenheim J
        • Matsushima K
        The neutrophil-activating protein (NAP-1) is also chemotactic for T lymphocytes.
        Science. 1989; 243: 1464-1466
        • Rot A
        • Krieger M
        • Brunner T
        • Bischoff SC
        • Schall TJ
        • Dahinden CA
        RANTES and macrophage inflammatory protein 1α induce the migration and activation of normal human eosinophil granulocytes.
        J Exp Med. 1992; 176: 1489-1495
        • Schall T
        • Bacon K
        • Toy K
        • Goeddel D
        Selective attraction of monocytes and T lymphocytes of the memory phenotype by cytokine RANTES.
        Nature. 1990; 347: 669-671
        • Eckmann L
        • Kagnoff MF
        • Fierer J
        Epithelial cells secrete the chemokine interleukin-8 in response to bacterial entry.
        Infect Immun. 1993; 61: 4569-4574
        • Crowe SE
        • Alvarez L
        • Dytoc M
        • Hunt RH
        • Muller M
        • Sherman PM
        • Patel J
        • Jin Y
        • Ernst PB
        Expression of interleukin-8 and CD54 by human gastric epithelium after Helicobacter pylori infection in vitro.
        Gastroenterology. 1995; 108: 65-74
        • Jung HC
        • Eckmann L
        • Yang S-K
        • Panja A
        • Fierer J
        • Morzycka-Wroblewska E
        • Kagnoff MF
        A distinct array of proinflammatory cytokines is expressed in human colon epithelial cells in response to bacterial invasion.
        J Clin Invest. 1995; 95: 55-65
        • Rasmussen S
        • Eckmann L
        • Quayle A
        • Shen L
        • Zhang Y
        • Anderson D
        • Fierer J
        • Stephens R
        • Kagnoff M
        Secretion of proinflammatory cytokines by epithelial cells in response to chlamydia infection suggests a central role of epithelial cells in chlamydial pathogenesis.
        J Clin Invest. 1997; 99: 77-87
        • Yang S-K
        • Eckmann L
        • Panja A
        • Kagnoff MF
        Differential and regulated expression of C-X-C, C-C, and C-chemokines by human epithelial cells.
        Gastroenterology. 1997; 113: 1214-1223
        • Ebert E
        IL-8, RANTES, and GRO are chemotactic for intraepithelial lymphocytes (IEL).
        Gastroenterology. 1995; 109: 1154-1159
        • Arnold R
        • Humbert B
        • Werchau H
        • Gallati H
        • Konig W
        Interleukin-8, interleukin-6, and soluble tumor necrosis factor receptor type I release from a human pulmonary epithelial cell line (A549) exposed to respiratory syncytial virus.
        Immunology. 1994; 82: 126-133
        • Becker S
        • Koren HS
        • Henke DC
        Interleukin-8 expression in normal nasal epithelium and its modulation by infection with respiratory syncytial virus and cytokines tumor necrosis factor, interleukin-1, and interleukin-6.
        Am J Respir Cell Mol Biol. 1993; 8: 20-27
        • Choi A
        • Jocoby D
        Influenza virus A infection induced interleukin-8 gene expression in human air way epithelial cells.
        FEBS Lett. 1992; 309: 327-329
        • Saito T
        • Deskin R
        • Casola A
        • Haeberle H
        • Olzewska B
        • Alam R
        • Ogra P
        • Garofalo R
        Respiratory syncytial virus induces the selective release of RANTES by upper air way epithelial cells.
        J Infect Dis. 1997; 175: 497-504
        • Fogh J
        • Orfeo T
        One hundred and twenty seven human tumor cell lines producing tumors in nude mice.
        J Natl Cancer Inst. 1977; 59: 221-226
        • Pinto M
        • Robine-leon S
        • Appay MD
        • Kedinger M
        • Triadou N
        • Dussaulx E
        • Lacroix B
        • Simon-Assmann P
        • Haffen K
        • Fogh J
        • Zweibaum A
        Enterocyte-like differentiation and polarization of the human colon carcinoma cell line Caco-2 in culture.
        Biol Cell. 1983; 47: 323-330
        • Zweilbaum E
        • Laburtha M
        • Grasset E
        • Lauvard D
        Use of cultured cell lines in studies of intestinal cell differentiation and function.
        in: Handbook of physiology. Section 6. The gastrointestinal system. Volume IV. American Physiological Society, Bethesda, MD1991: 223-225
        • Augeron C
        • Laboisse C
        Emergence of permanently differentiated cell clones in a human colonic cancer cell line in culture after treatment with sodium butyrate.
        Cancer Res. 1984; 44: 3961-3969
        • Estes M
        • Graham D
        • Gerba C
        • Smith E
        Simian rotavirus SA11 replication in cell culture.
        J Virol. 1979; 31: 810-815
        • Smith EM
        • Estes MK
        • Graham DY
        • Gerba CP
        A plaque assay for the simian rotavirus SA11.
        J Gen Virol. 1979; 43: 515-521
        • Crawford S
        • Labbe M
        • Cohen J
        • Burroughs M
        • Zhou Y
        • Estes M
        Characterization of virus-like particles produced by the expression of rotavirus capsid proteins in insect cells.
        J Virol. 1994; 68: 5945-5952
        • Groene W
        • Shaw R
        Psoralen preparation of antigenically intact noninfectious rotavirus particles.
        J Virol Methods. 1992; 38: 93-102
        • Patel JA
        • Kunimoto M
        • Sim TC
        • Garofalo R
        • Eliott T
        • Baron S
        • Ruuskanen O
        • Chonmaitree T
        • Ogra PL
        • Schmalstieg F
        Interleukin-1α mediates the enhanced expression of intercellular adhesion molecule-1 in pulmonary epithelial cells infected with respiratory syncytial virus.
        Am J Respir Cell Mol Biol. 1995; 13: 602-609
        • Chomczynski P
        • Sacchi N
        Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction.
        Anal Biochem. 1987; 162: 156-159
        • Garofalo R
        • Sabry M
        • Jamaluddin M
        • Yu R
        • Casola A
        • Ogra P
        • Brasier A
        Transcriptional activation of the interleukin-8 gene by respiratory syncytial virus infection in alveolar epithelial cells: nuclear translocation of the RelA transcription factor as a mechanism producing air way mucosal inflammation.
        J Virol. 1996; 70: 8773-8781
        • Becker S
        • Quay J
        • Koren H
        • Haskill J
        Constitutive and stimulated MCP-1, GRO alpha, beta, and gamma expression in human air way epithelium and bronchoalveolar macrophages.
        Am J Physiol. 1994; 266: L2278-L2286
        • Sheth R
        • Anderson J
        • Sato T
        • Oh B
        • Hempson SJ
        • Rollo E
        • Mackow ER
        • Shaw RD
        Rotavirus stimulates IL-8 secretion from cultured epithelial cells.
        Virology. 1996; 221: 251-259
        • Superti F
        • Tinari A
        • Baldassarri L
        • Donelli G
        HT29 cells: a new substrate for rotavirus growth.
        Arch Virol. 1991; 116: 159-173
        • Kitamoto N
        • Ramig RF
        • Matson DO
        • Estes MK
        Comparative growth of different rotavirus strains in differentiated cells (MA104, HepG2, and CaCo-2).
        Virology. 1991; 184: 729-737
        • Zhu Z
        • Tang W
        • Ray A
        • Wu Y
        • Einarsson O
        • Landry ML
        • Gwaltney J
        • Elias JA
        Rhinovirus stimulation of interleukin-6 in vivo and in vitro: evidence for nuclear factor κB—dependent transcriptional activation.
        J Clin Invest. 1996; 97: 421-430
        • Franco M
        • Greenberg H
        Role of B cells and cytotoxic T lymphocytes in clearance of an immunity to rotavirus infection in mice.
        J Virol. 1995; 69: 7800-7806
        • McNeal M
        • Barone K
        • Rae M
        • Ward R
        Effector functions of antibody and CD8+ cells in resolution of rotavirus infection and protection against reinfection in mice.
        Virology. 1995; 213: 387-397
        • Franco MA
        • Tin C
        • Greenberg HB
        CD8+ T cells can mediate almost complete short-term and partial long-term immunity to rotavirus in mice.
        J Virol. 1997; 71: 4165-4170
        • Davidson GP
        • Barnes GL
        Structural and functional abnormalities of the small intestine in infants and young children with rotavirus enteritis.
        Acta Paediatr Scand. 1979; 68: 181-186
        • Yason C
        • Summers B
        • Schat K
        Pathogenesis of rotavirus infection in various age groups of chickens and turkeys: pathology.
        Am J Vet Res. 1987; 48: 927-938
        • Snodgrass D
        • Angus K
        • Gray E
        Rotavirus infection in lambs: pathogenesis and pathology.
        Arch Virol. 1977; 55: 263-277
        • Griffiths C
        • Barker J
        • Kunkel S
        • Nickoloff B
        Modulation of leukocyte adhesion molecules, a T-cell chemotaxin (IL-8) and a regulatory cytokine (TNF-α) in allergic contact dermatitis (rhus dermatitis).
        Br J Dermatol. 1991; 124: 519-526