Advertisement

Hepatic autoantigens in patients with autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy

      Abstract

      Background & Aims: Autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) is caused by mutations of both copies of the autoimmune regulator (AIRE) gene. It is characterized by susceptibility to mucocutaneous candidiasis and multiple autoimmune lesions. A serious disease component is hepatitis. To identify diagnostic autoantibodies for APECED hepatitis, sera from 64 patients with APECED were screened for autoantibodies established in the diagnosis of idiopathic autoimmune hepatitis, and for autoantibodies against 10 cytochrome P450s. Methods: Screening methods were indirect immunofluorescence, Western blot, Ouchterlony gel diffusion, enzyme-linked immunosorbent assay, and immunoprecipitation. Results: Anti-liver microsomal antibodies were detected in 50% of the patients with APECED hepatitis and 11% of those without hepatitis. Prevalences of antinuclear, smooth muscle, anti-liver cytosol, anti-soluble liver protein/liver pancreas, and anti-CYP2D6 autoantibodies were 9%, 6%, 3%, 0%, and 0%, respectively. CYP1A1, CYP2B6, CYP1A2, and CYP2A6 were identified as autoantigens. Thirty percent of patients with anti-CYP2A6 and 100% of patients with anti-CYP1A2 were affected by hepatitis. Despite the high specificity of anti-CYP1A2 for APECED hepatitis, its sensitivity was low (50%). Anti-CYP2A6 and anti-CYP1A2 were not detected in patients with autoimmune hepatitis (N = 68) or nonhepatitic controls (N = 81). Conclusions: Anti-CYP1A2 is a highly specific but insensitive marker for APECED hepatitis. No clinical correlation was observed for anti-CYP2A6. Autoimmune hepatitis and APECED hepatitis are characterized by different molecular targets of autoantibodies with no overlap.
      GASTROENTEROLOGY 2001;121:668-677

      Abbreviations:

      AIH (autoimmune hepatitis), AIRE (autoimmune regulator), ANA (anti-nuclear antibodies), anti-SLA/LP (anti-soluble liver protein/liver pancreas), APECED (autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy), ARD (autoimmune rheumatoid disease), ASL (argininosuccinate lyase), ELISA (enzyme-linked immunosorbent assay), FTCD (formiminotransferase cyclodeaminase), LC (liver cytosolic), LKM (anti-liver/kidney microsomal), LM (liver microsomal), RT-PCR (reverse transcriptase-polymerase chain reaction), SMA (smooth muscle antibody)
      Autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED, OMIM No. 240300) is an autosomal recessive disorder based on a defect of both copies of the autoimmune regulator gene (AIRE).
      • Nagamine K
      • Peterson P
      • Scott HS
      • Kudoh J
      • Minoshima S
      • Heino M
      • Krohn KJE
      • Lalioti MD
      • Mullis PE
      • Antonarakis SE
      • Kawasaki K
      • Asakawa S
      • Ito F
      • Shimiziu N
      Positional cloning of the APECED gene.
      • Finnish-German APECED Consortium
      An autoimmune disease, APECED, caused by mutations in a novel gene featuring two PHD-type zinc finger domains.
      APECED shows 100% penetrance, lack of dependence from the human leukocyte antigens, and equal incidence in both genders.
      • Ahonen P
      • Myllärniemi S
      • Sipilä I
      • Perheentupa J
      Clinical variation of autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) in a series of 68 patients.
      • Perheentupa J
      • Miettinen A
      Type 1 autoimmune polyglandular disease.
      It includes 3 groups of components: (1) mucocutaneous candidiasis; (2) autoimmune tissue destruction, predominantly of the endocrine glands; and (3) ectodermal dystrophy.
      • Ahonen P
      • Myllärniemi S
      • Sipilä I
      • Perheentupa J
      Clinical variation of autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) in a series of 68 patients.
      • Perheentupa J
      • Miettinen A
      Type 1 autoimmune polyglandular disease.
      Several of the autoimmune manifestations are associated with circulating autoantibodies directed against specific enzymes, CYP21A2 in adrenocortical insufficiency,
      • Uibo R
      • Aavik E
      • Peterson P
      • Perheentupa J
      • Aranko S
      • Pelkonen R
      • Krohn KJ
      Autoantibodies to cytochrome P450 enzymes P450scc, P450c17, and P450c21 in autoimmune polyglandular disease types I and II and in isolated Addison's disease.
      • Winqvist O
      • Gebre-Mehedin G
      • Gustafsson J
      • Ritzen EM
      • Lundquist Ö
      • Karlsson FA
      • Kämpe O
      Identification of main gonadal autoantigens in patients with adrenal insufficiency and associated ovarian failure.
      • Krohn K
      • Uibo R
      • Aavik E
      • Peterson P
      • Savilahti K
      Identification by molecular cloning of an auto-antigen associated with Addison disease as steroid 17α-hydroxylase.
      CYP11A1 and CYP17 in adrenocortical and ovarian failures,
      • Winqvist O
      • Gebre-Mehedin G
      • Gustafsson J
      • Ritzen EM
      • Lundquist Ö
      • Karlsson FA
      • Kämpe O
      Identification of main gonadal autoantigens in patients with adrenal insufficiency and associated ovarian failure.
      • Krohn K
      • Uibo R
      • Aavik E
      • Peterson P
      • Savilahti K
      Identification by molecular cloning of an auto-antigen associated with Addison disease as steroid 17α-hydroxylase.
      tryptophan hydroxylase in disorders of intestinal motility,
      • Ekwall O
      • Hedstrand H
      • Grimelius L
      • Haavik J
      • Perheentupa J
      • Gustafsson J
      • Husebye E
      • Kämpe O
      • Rorsman F
      Identification of tryptophan hydroxylase as an intestinal autoantigen.
      and tyrosine hydroxylase in alopecia.
      • Hedstrand H
      • Ekwall O
      • Haavik J
      • Landgren E
      • Betterle B
      • Perheentupa J
      • Gustafsson J
      • Huse-bye E
      • Rorsman F
      • Kämpe O
      Identification of tyrosine hydroxylase as an autoantigen in auto-immune polyendocrine syndrome type I.
      APECED might serve as a model disease for the study of organ-specific autoimmunity, because this disease is determined by a defect in a single gene pair, and many molecular targets associated with its autoimmune processes are known. Once diagnosed, the patients may be regularly screened for new autoantibodies heralding the development of new disease components. As an example, adrenal and steroidal cell autoantibodies may be detected 2–3 years before corresponding clinical diseases.
      • Ahonen P
      • Miettinen A
      • Perheentupa J
      Adrenal and steroidal cell antibodies in patients with autoimmune polyglandular disease type I and risk of adrenocortical and ovarian failure.
      Once risk factors become identified, preventive approaches may be developed.
      Hepatitis develops in 10%–20% of the patients.
      • Neufeld M
      • Maclaren N
      • Blizzard R
      Autoimmune polyglandular syndromes.
      • Betterle C
      • Greggio NA
      • Volpato M
      Autoimmune polyglandular syndrome type 1.
      Its spectrum ranges from an asymptomatic self-limited to a fulminant disease with lethal outcome.
      • Ahonen P
      • Myllärniemi S
      • Sipilä I
      • Perheentupa J
      Clinical variation of autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) in a series of 68 patients.
      • Betterle C
      • Greggio NA
      • Volpato M
      Autoimmune polyglandular syndrome type 1.
      • Michele TM
      • Fleckenstein J
      • Sgrignoli AR
      • Tuluvath PJ
      Chronic active hepatitis in the type I polyglandular autoimmune syndrome.
      • Clemente M-G
      • Meloni A
      • Obermayer-Straub P
      • Frau F
      • Manns MP
      • DeVirgiliis S
      Two cytochromes P450 are major hepatocellular autoantigens in autoimmune polyglandular syndrome type 1.
      Fulminant hepatitis may develop without prewarning signs.
      • Ahonen P
      • Myllärniemi S
      • Sipilä I
      • Perheentupa J
      Clinical variation of autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) in a series of 68 patients.
      • Michele TM
      • Fleckenstein J
      • Sgrignoli AR
      • Tuluvath PJ
      Chronic active hepatitis in the type I polyglandular autoimmune syndrome.
      • Clemente M-G
      • Meloni A
      • Obermayer-Straub P
      • Frau F
      • Manns MP
      • DeVirgiliis S
      Two cytochromes P450 are major hepatocellular autoantigens in autoimmune polyglandular syndrome type 1.
      Identification of hepatic autoantibodies may facilitate the diagnosis of autoimmune hepatitis (AIH) and identification of patients at risk of it.
      In AIH, which occurs independent of APECED, circulating autoantibodies are found in approximately 80% of the patients.
      • Obermayer-Straub P
      • Strassburg CP
      • Manns MP
      Autoimmune hepatitis.
      Based on autoantibody patterns, AIH can be subdivided into at least 2 clinically distinct subtypes: AIH-1 and AIH-2.
      • Obermayer-Straub P
      • Strassburg CP
      • Manns MP
      Autoimmune hepatitis.
      • Czaja AJ
      • Manns MP
      The validity and importance of subtypes in autoimmune hepatitis: a point of view.
      AIH-1 is characterized by antinuclear autoantibodies (ANA) and/or smooth muscle antibodies (SMA).
      • Czaja AJ
      • Manns MP
      The validity and importance of subtypes in autoimmune hepatitis: a point of view.
      Highly specific for AIH are also antibodies directed against soluble liver antigen/liver pancreas antigen (SLA/LP).
      • Manns M
      • Gerken G
      • Kyriatsoulis A
      • Staritz M
      • Meyer zum Büschenfelde KH
      Characterization of a new subgroup of autoimmune chronic active hepatitis by autoantibodies against a soluble liver antigen.
      • Stechemesser E
      • Klein R
      • Berg PA
      Characterization and clinical relevance of liver-pancreas antibodies in autoimmune hepatitis.
      • Wies I
      • Brunner S
      • Henninger J
      • Herkel J
      • Kanzler S
      • Meyer zum Büschenfelde KH
      • Lohse AW
      Identification of target antigen for SLA/Lp autoantibodies un autoimmune hepatitis.
      Autoantibodies against neutrophilic antigens may also be detected with a high prevalence.
      • Targan SR
      • Landers C
      • Vidrich A
      • Czaja AJ
      High titer antineutrophil cytoplasmic antibodies in type-1 autoimmune hepatitis.
      There is little overlap of autoantibodies between patients affected by AIH-1 and AIH-2.
      • Obermayer-Straub P
      • Strassburg CP
      • Manns MP
      Autoimmune hepatitis.
      • Czaja AJ
      • Manns MP
      The validity and importance of subtypes in autoimmune hepatitis: a point of view.
      Patients with AIH-2 are characterized by liver-kidney microsomal autoantibodies (LKM-1). Often associated with AIH-2 are autoantibodies against liver cytosolic antigen (LC1) and less frequently against UDP-glucuronosyltransferases (anti-LKM3).
      • Martini E
      • Abuaf N
      • Cavalli F
      • Durand V
      • Johanet C
      • Homberg JC
      Antibody to liver cytosol (anti-LC1) in patients with autoimmune hepatitis type 2.
      • Strassburg C
      • Obermayer-Straub P
      • Alex B
      • Durazzo M
      • Rizzetto M
      • Tukey RH
      • Manns MP
      Autoantibodies against glucuronosyltransferases differ between viral hepatitis and autoimmune hepatitis.
      Prevalence and diagnostic value of autoantibodies associated with idiopathic AIH remain to be determined for patients with APECED-hepatitis.
      In APECED, molecular targets of different hepatic autoantibodies have been identified: cytochrome P4501A2 (CYP1A2),
      • Clemente MG
      • Obermayer-Straub P
      • Meloni A
      • Strassburg CP
      • Arangino V
      • Tukey RH
      • De Virgiliis S
      • Manns MP
      Cytochrome P450 1A2 is a hepatic autoantigen in autoimmune polyglandular syndrome type 1.
      • Gebre-Medhin G
      • Husebye ES
      • Gustafsson J
      • Winqvist O
      • Goksoyr A
      • Rorsman F
      • Kämpe O
      Cytochrome P450IA2 and aromatic L-amino acid decarboxylase are hepatic autoantigens in autoimmune polyendocrine syndrome type I.
      cytochrome P4502A6 (CYP2A6),
      • Clemente M-G
      • Meloni A
      • Obermayer-Straub P
      • Frau F
      • Manns MP
      • DeVirgiliis S
      Two cytochromes P450 are major hepatocellular autoantigens in autoimmune polyglandular syndrome type 1.
      and L-amino acid decarboxylase (AADC).
      • Husebye ES
      • Gebre-Mehedin G
      • Tuomi T
      • Perheentupa J
      • Landin-Olsson M
      • Gustafsson J
      • Rorsman F
      • Kämpe O
      Autoantibodies against aromatic-L-amino acid decarboxylase in autoimmune polyendocrine syndrome.
      Anti-CYP1A2 autoantibodies have been described in 5 patients with APECED hepatitis.
      • Clemente M-G
      • Meloni A
      • Obermayer-Straub P
      • Frau F
      • Manns MP
      • DeVirgiliis S
      Two cytochromes P450 are major hepatocellular autoantigens in autoimmune polyglandular syndrome type 1.
      • Clemente MG
      • Obermayer-Straub P
      • Meloni A
      • Strassburg CP
      • Arangino V
      • Tukey RH
      • De Virgiliis S
      • Manns MP
      Cytochrome P450 1A2 is a hepatic autoantigen in autoimmune polyglandular syndrome type 1.
      • Gebre-Medhin G
      • Husebye ES
      • Gustafsson J
      • Winqvist O
      • Goksoyr A
      • Rorsman F
      • Kämpe O
      Cytochrome P450IA2 and aromatic L-amino acid decarboxylase are hepatic autoantigens in autoimmune polyendocrine syndrome type I.
      • Sacher M
      • Blümel P
      • Thaler H
      • Manns M
      Chronic active hepatitis associated with vitiligo, nail dystrophy, alopecia and a new variant of LKM antibodies.
      • Manns MP
      • Griffin KJ
      • Quattrochi L
      • Sacher M
      • Thaler H
      • Tukey RH
      • Johnson EF
      Identification of cytochrome P450 IA2 as a human autoantigen.
      Anti-CYP2A6 autoantibodies were detected in 2 patients, 1 with slight elevations of serum alanine aminotransferase (ALT) and in another with fulminant hepatitis.
      • Clemente M-G
      • Meloni A
      • Obermayer-Straub P
      • Frau F
      • Manns MP
      • DeVirgiliis S
      Two cytochromes P450 are major hepatocellular autoantigens in autoimmune polyglandular syndrome type 1.
      Because of the small number of patients, it is unknown whether these autoantibodies are diagnostic or just coincidental in patients with APECED hepatitis. Autoantibodies against AADC were present in 92% of Finnish patients with APECED hepatitis, but they were also frequent in those with no other signs of hepatitis.
      • Husebye ES
      • Gebre-Mehedin G
      • Tuomi T
      • Perheentupa J
      • Landin-Olsson M
      • Gustafsson J
      • Rorsman F
      • Kämpe O
      Autoantibodies against aromatic-L-amino acid decarboxylase in autoimmune polyendocrine syndrome.

      Materials and methods

       Patients

      All studies described in this report were approved by the Ethics Committee of the Medical School of Hanover and the Hospital for Children and Adolescents of the University of Helsinki. We studied sera from 64 Finnish patients with APECED (1–60 years, 34 male)
      • Ahonen P
      • Myllärniemi S
      • Sipilä I
      • Perheentupa J
      Clinical variation of autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) in a series of 68 patients.
      for hepatic autoantibodies. Of these patients, 8 were affected by hepatitis, as defined by supranormal serum levels of ALT and liver morphology (Table 1). Six of 8 patients were on long-term glucocorticoid treatment since the diagnosis of hepatitis, whereas 2 patients only had mild disease (E.M. and T.M., Table 1). One patient died from hepatic necrosis and listeria meningitis (M.M.). None was infected by hepatitis viruses B, C, or D. Two control groups of healthy blood donors were included, 17 from Finland (6–27 years, 8 male), and 33 from Germany (24–63 years, 17 male). Also, we studied a group of 45 patients with AIH (14–70 years, 10 male) and 23 patients with AIH-2 (9–51 years, 2 male). Sixteen patients with AIH-1 were selected for positivity for ANA and negativity for anti-SLA-LP (16–64 years, 2 male). SMA positivity in this patient group was 62%. Twenty-nine patients were selected for SLA/LP-positivity (16–70 years, 8 male). In this patient group 25% were also positive for ANA and 46% were also positive for SMA. Furthermore, we included 31 patients with autoimmune rheumatoid diseases (ARD) (18–77 years, 4 male) from Germany: 15 with systemic lupus erythematosus, 10 with mixed connective tissue disease, and 6 with rheumatoid arthritis.
      • Strassburg C
      • Alex B
      • Zindy F
      • Gerken G
      • Lüttig B
      • Meyer zum Büschenfelde KH
      • Bréchot C
      • Manns M
      Identification of cyclin A as a molecular target of antinuclear antibodies (ANA) in hepatic and non-hepatic diseases.
      Table 1Patients with APECED hepatitis: Levels of CYP1A2 are available only for the ages indicated
      Patient (sex)Serum anti-CYP1A2aSerum ALT (IU)Liver biopsyImmunosuppressive medicationClinics
      EB (m)+++ at 1.0, 8, and 9 + at 10 and 11fluctuating, at 0.7–4; between 1000 IU to 20 IU thereafter n to 550 IUn at 1.0; chronic hepatitis at 1.6, 3.2, 13Prednisone 1-7 and 9- azathioprine 6-10; cyclosporin A 10-Dermal vasculitis 0.7-; adrenocortical failure 4-; alopecia 9-; obliterating bronchiolitis organizing pneumonia 9-; failure of bile reabsorption 12-
      ER (f)+++ at 14, ++ at 15, 16, and 172630 IU at 5.8–6.4; thereafter n to 240 IUat 6.5; chronic hepatitis slight nonspecific reaction at 15Prednisone 6-8 and 15- azathioprine 15-Acute hepatitis 5, 8; adrenocortical failure 7-; hypoparathyroidism 8-; alopecia 10-; primary ovarian failure; atrophic gastritis 15-
      PS (m)+++ at 6, 7, and 9 + at 15 and 16fluctuating, since 4 between 154 IU and nat 7.1, 8.7 chronic hepatitis at 9.4 mild inflammation at 10.8 inactivePrednisone 8-10Hypoparathyroidism 3-; adrenocortical failure 7-
      EM (m)+ at 13, n at 15–35 (12 samples)fluctuating at 2.7–3.2 1190 IU to 15 IU thereafter nat 3.1 chronic hepatitis; at 12 minimal lymphocytic infiltrationnoneHypoparathyroidism 4-; keratopathy 5-; gonadotropin deficiency 14-; hypothyroidism 32-
      MM (f)n at 10–13 (5 samples)since 12.4 55 IU to 560 IUautopsy: extensive necrosisMethylprednisolone 13Keratopathy 4-; alopecia 5-; hypoparathyroidism 5-; adrenocortical failure 6-; acute lethal hepatic failure 13
      TK (f)n at 14, 15, and 17fluctuating at 7.2–9.8 50 IU-630 IU thereafter n to 260 IUat 8.0 slight increase in lymphocytes & periportal connective tissue; at 9.6 chronic hepatitis; at 10.8 same as at 8.0Prednisone 9-11, and 12-15 azathioprine 14-Adrenocortical failure 4-; hypoparathyroidism 5-; vitiligo 13-; primary ovarian failure; atrophic gastritis 15-
      PB (m)n at 7–17 (9 samples)at 7–13 169 IU to 46 IU and again since 17at 7.4 mild lymphocytic inflammation in portal areas; at 17 chronic hepatitisPrednisone & azathioprine 17-Steatorrhea 4-; adrenocortical failure 5-; vitiligo 5-; hypoparathyroidism 6-; growth hormone deficiency 9-
      TM (m)n at 10–25.1 (6 samples)at 10.0 n (1 determination, IgG 24 g/L) at 25.1 73 IU thereafter nat 25.1 slight increase in periportal lymphocytes & connective tissuenoneHypoparathyroidism 1.7- adrenocortical failure (transient) 8-; vitiligo 11-; alopecia 13-
      aAll existing values are given; +, ++, +++ increasing degrees of supernormality, ALT (IU), n negative, normal.
      NOTE. All patients had chronic or periodic mucocutaneous candidiasis. Numbers indicate ages in years.

       Methods

       Hepatitis virus diagnostics

      Tests for hepatitis B, C, and D were as described.
      • Dalekos GN
      • Wedemeyer H
      • Obermayer-Straub P
      • Kayser A
      • Barut A
      • Frank H
      • Manns MP
      Epitope mapping of cytochrome P4502D6 autoantigen in patients with chronic hepatitis C during α-interferon treatment.

       Indirect immunofluorescence

      Indirect immunofluorescence for ANA, SMA, LKM, and LM autoantibodies was performed with frozen sections of rat liver and kidney tissue and sera at dilutions of 1:40, 1:80, and 1:160 in phosphate-buffered saline.
      • Dalekos GN
      • Wedemeyer H
      • Obermayer-Straub P
      • Kayser A
      • Barut A
      • Frank H
      • Manns MP
      Epitope mapping of cytochrome P4502D6 autoantigen in patients with chronic hepatitis C during α-interferon treatment.
      The cut-off value for positivity for all autoantibodies tested was 1:80.

       AHH-1 TK +/− derived cell lines for the expression of single CYP isoforms, the epoxide hydrolase and the P450 reductase

      Microsomes from AHH1 TK+/− derived expression cell lines containing well-defined recombinant proteins were purchased from Natutec (Frankfurt, Germany). The AHH1 TK+/− derived expression cell lines contained vectors with expression cassettes containing complementary DNA (cDNA) for the expression of specific CYP isoforms, the epoxide hydrolase, or the cytochrome P450 reductase. From transfected AHH-1 TK+/− cells Natutec selected stable cell lines, expressing high levels of the respective enzymatically active recombinant proteins.

       Western blots

      Immunoblotting was performed as described.
      • Dalekos GN
      • Wedemeyer H
      • Obermayer-Straub P
      • Kayser A
      • Barut A
      • Frank H
      • Manns MP
      Epitope mapping of cytochrome P4502D6 autoantigen in patients with chronic hepatitis C during α-interferon treatment.
      Microsomes derived from AHH-1 expression cell lines were used for Western blots, containing 5 pmol of a single isotype of CYP protein, the epoxide hydrolase, or cytochrome P450 reductase. Proteins were separated on 10% polyacrylamide gels and transferred to nitrocellulose. Detection of autoantibodies was performed with a 1:100 dilution of the patient sera and a 1:1000 dilution of an alkaline phosphatase conjugated goat anti-human immunoglobulin (Ig) M, IgG, and IgD antibody (Dianova, Hamburg, Germany). The color reaction was performed with 5-bromo-1-chloro-3-indolyl phosphate and nitro blue tetrazolium as substrates (Promega, Madison, WI).

       Construction of pCITE-4a expression vectors

      • Construction of pCITE-CYP2A6. Two overlapping fragments of CYP2A6 (GenEMBL, M33316 and M33318) were generated by reverse-transcription polymerase chain reaction (RT-PCR). RT reaction was performed with 500 ng total liver RNA and 0.8 μg oligo-dT according to the supplier's instructions. Primers used for the amplification of the 5'-fragment (1-820 bp) were 5'GACTGAATTCCTGGCCTCAGGGATGCTTC3' and 5'ATGCGGATGAGAAAGGAGTC3', for the 3' fragment (726-1485) 5'AGGGCTGGAGGACTT-CATA3' and 5'GATCCTCGAGCGGCACAGCCCTCGCTCAGC3'. PCR was performed with “Superscript” Taq DNA polymerase according to the manufacturer's suggestions (Life Technologies, Hilden, Germany). Thirty cycles of PCR were performed: (1) denaturation at 94°C for 1 minute, (2) annealing at 58°C for 2 minutes, and (3) extension at 72°C for 3 minutes. An additional extension step at 72°C for 7 minutes was added to the last cycle. BamHI digestion was performed on both PCR fragments at a common BamHI site. Ligation by T4 ligase resulted in a full length CYP2A6 cDNA, which was inserted into the EcoRI and Xho1 sites of the pCITE-4a vector (Novagen, Abingdon, England).
      • Construction of pCITE-CYP1A2. The CYP1A2 cDNA was amplified from the pBS/1A2 vector using the primers 5'CATTGGATTCGCATTGTCCCAGTCTGTTCC3' and 5'CTGACTCGA-GTCTTCAATTGATGGAGAACG3'. PCR was performed as described under (1). The cDNA was inserted into BamHI and Xho1 sites of pCITE4a.
      • Construction of pCITE-CYP2D6. The construction of pCITE-CYP2D6 expression vector was described.
        • Dalekos GN
        • Wedemeyer H
        • Obermayer-Straub P
        • Kayser A
        • Barut A
        • Frank H
        • Manns MP
        Epitope mapping of cytochrome P4502D6 autoantigen in patients with chronic hepatitis C during α-interferon treatment.
      • Construction of the human pCITE-FTCD. Sequence data of formiminotransferase cyclodeaminase (FTCD) (GenEMBL Access. Nos. U91541 and AI767489) were used to construct the primers 3'CTACGAATTCGTCAGCGTGGATGAGTGTGTGCTCTGC5' and 3'CTAGCTCGAGCTGCTGTCCCTGGGGTTTAGTCACTC5' for the amplification of the FTCD cDNA.
        • Lapierre P
        • Hajoui O
        • Homberg J-C
        • Alvarez F
        Fomiminotransferase cyclodeaminase is an organ specific autoantigen recognized by sera of patients with autoimmune hepatitis.
        RT-PCR was performed as described under (1) except that 10% dimethylsulfoxide was added to the PCR buffer. The cDNA product was inserted into the EcoRI and Xho1 sites of pCITE 4A.
      • Construction of pCITE-argininosuccinate lyase (ASL). Argininosuccinate lyase (GenEMBL Access. No. J03058) was amplified by RT-PCR as described under (4) with the primers 5'GATCGGATCCATGGCCTCGGA-GAGTGGGAAGCTTTGG3' and 5'CTAGCTCGAGCCTAGGCCTGCTGTGCCTGCAGTAGGCG3'. The cDNA product was inserted into the BamHI and Xho1 sites of pCITE 4A.

       Immunoprecipitation assays

      In vitro transcription/in vitro translation was performed with 2 μg DNA of the respective pCITE expression vector, 50 μCi [35S]-methionine (Amersham, Braunschweig, Germany) and 40 μL of the TNT T7 Quick Coupled Transcription Translation kit (Promega, Madison, WI) in a final volume of 50 μL. The reaction mixture was incubated at 30°C for 90 minutes. [35S]-labeled protein was separated from free [35S]-methionine by gel filtration on Sephadex G10 (BioRad, Munich, Germany). The amount of [35S]-labeled protein obtained was quantified after sodium dodecyl sulfate-polyacrylamide gel electrophoresis by a Fujix Bas 1000 bioimaging analyzer (Raytest, Straubenhardt, Germany). Then, 100,000 cpm of [35S]-labeled protein was incubated overnight at 4°C with 0.5 μL of patient serum in a final volume of 100 μL incubation buffer (100 mmol/L Tris-Cl pH 7.4, 150 mmol/L NaCl, 0.5% Tween-20, 0.1% bovine serum albumin, 1.0 mmol/L phenylmethansulfonylfluorid). Antibody-[35S]-protein-complexes were bound to 25 μL of protein A agarose (BioRad, Munich, Germany) by incubation at 4°C for 30 minutes. Agarose-complexes were washed 3 times with 750 μL incubation buffer. The final pellet was resuspended in 50 μL washing buffer and mixed with 1 mL scintillation fluid (Optiphase Supermix, Wallac, Turku, Finland). The amount of [35S]-labeled protein was determined by a 1450 Micro Beta Trilux Counter (Wallac, Turku, Finland). Results were expressed as units of immunoprecipitated [35S]-protein according to following formula
      • Gebre-Medhin G
      • Husebye ES
      • Gustafsson J
      • Winqvist O
      • Goksoyr A
      • Rorsman F
      • Kämpe O
      Cytochrome P450IA2 and aromatic L-amino acid decarboxylase are hepatic autoantigens in autoimmune polyendocrine syndrome type I.
      :Usample = (cpmsample − cpmneg. control/cpmpos. control − cpmneg. control) ×1000.
      Every sample with values more than the mean value of healthy controls plus 3 SD was considered positive, resulting in the following cut-off points: 6.1 U for anti-CYP1A2, 25 U for anti-CYP2A6, and 12.9 U for CYP2D6.

       Competitive SLA/LP ELISA

      SLA/LP autoantibodies were detected by a competitive enzyme-linked immunosorbent assay (ELISA).
      • Manns M
      • Gerken G
      • Kyriatsoulis A
      • Staritz M
      • Meyer zum Büschenfelde KH
      Characterization of a new subgroup of autoimmune chronic active hepatitis by autoantibodies against a soluble liver antigen.

       Detection of LC autoantibodies by the Ouchterlony gel diffusion assay

      Results of the Ouchterlony double immunodiffusion assay
      • Martini E
      • Abuaf N
      • Cavalli F
      • Durand V
      • Johanet C
      • Homberg JC
      Antibody to liver cytosol (anti-LC1) in patients with autoimmune hepatitis type 2.
      were controlled by a standard positive LC1 serum provided by Prof. Homberg (L'Hopital St-Antoine, Paris, France).

      Results

       Relevance of established autoantibody markers of AIH in APECED hepatitis

      Sera from the patients with APECED, 8 with hepatitis and 56 without hepatitis, were tested for the autoantibodies used in the diagnosis of AIH (Figure 1).
      Figure thumbnail gr1
      Fig. 1Prevalence of hepatic autoantibodies in patients with APECED. anti-LC, anti-liver cytosol; CYP, cytochrome P450.
      Antibodies typically detected in patients with AIH-1 are ANA, SMA, and/or anti-SLA/LP. ANA (≥1:80) were detected in 12.5% of APECED patients with hepatitis and 8.9% of those without it. The staining pattern was homogeneous in all APECED patients. These results are similar to the prevalence of ANA in healthy Finnish or German controls (5.9% and 9.1%, respectively). Similarly, SMA (≥1:80) were not detected in APECED patients with hepatitis, but in 7.1% without it. Again, prevalences were similar to the healthy Finnish and German control populations (10.8% and 6.1%, respectively). Anti-SLA/LP was not detected at all. These results show that autoantibodies used for diagnosis of AIH lack specificity for hepatitis in APECED.
      Anti-LKM1 and anti-LC1 associate with AIH-2.
      • Martini E
      • Abuaf N
      • Cavalli F
      • Durand V
      • Johanet C
      • Homberg JC
      Antibody to liver cytosol (anti-LC1) in patients with autoimmune hepatitis type 2.
      • Homberg JC
      • Abuaf N
      • Bernard O
      • Islam S
      • Alvarez F
      • Khalil SH
      • Poupon R
      • Darnis F
      • Levy VG
      • Grippon P
      Chronic active hepatitis associated with anti liver/kidney microsome type 1: a second type of “autoimmune” hepatitis.
      AIH-2 LKM autoantibodies, studied by indirect immunofluorescence, are characterized by a cytosolic staining of the liver and a staining of the proximal kidney tubules. In the patients with APECED, we observed 2 staining patterns: (1) the typical LKM pattern, and (2) a liver microsomal (LM) pattern with no staining of the kidney (LM). Thus at least 2 microsomal target antigens are involved. The prevalence in the patients with APECED was 7.9% for both anti-LKM and anti-LM. LKM or LM (LKM/LM) were more frequent in the patients with hepatitis (50%) than in those without it (10.7%) (Figure 1). To investigate whether the LKM staining pattern was caused by the same antigen as in AIH-2, we performed an immunoprecipitation test with recombinant [35S]-labeled CYP2D6 (Figure 2A).
      Figure thumbnail gr2
      Fig. 2Prevalence of anti-CYP2D6, anti-CYP2A6, and anti-CYP1A2 in APECED patients, with and without hepatitis, in patients with AIH-1, AIH-2, and in nonhepatic control groups. Immunoprecipitation of [35S]-labeled recombinant proteins was performed to screen for autoantibodies directed against (A) CYP2D6, (B) CYP2A6, and (C) CYP1A2. Cut-off values representing the mean value of Finnish healthy controls ± 3SD are 6.1 U for anti-CYP1A2, 25 U for anti-CYP2A6, and 12.9 U for CYP2D6.
      None of the patients with APECED hepatitis recognized CYP2D6, demonstrating that LKM autoantibodies detect different molecules in AIH and in APECED. Two of the sera from patients with APECED were positive for anti-LC in the Ouchterlony gel diffusion assay. One of these was from a patient with hepatitis, the other from one without hepatitis. Two proteins are known to result in positive signals in the Ouchterlony assay for anti-LC1 in AIH: FTCD and ASL.
      • Lapierre P
      • Hajoui O
      • Homberg J-C
      • Alvarez F
      Fomiminotransferase cyclodeaminase is an organ specific autoantigen recognized by sera of patients with autoimmune hepatitis.
      • Pelli N
      • Fensom AH
      • Slade C
      • Boa F
      • Mieli-Vergani G
      • Vergani D
      Argininosuccinate lyase: a new autoantigen in liver disease.
      To test whether one of these enzymes was recognized by the anti-LC positive sera from the patients with APECED, immunoprecipitation tests were performed with [35S]-labeled ASL, [35S]-labeled porcine FTCD, and the [35S]-labeled C-terminus of human FTCD (data not shown). The C-terminus of FTCD is recognized by all anti-LC1 positive sera in AIH.
      • Lapierre P
      • Hajoui O
      • Homberg J-C
      • Alvarez F
      Fomiminotransferase cyclodeaminase is an organ specific autoantigen recognized by sera of patients with autoimmune hepatitis.
      Although all 3 target proteins were recognized by sera from the patients with AIH, the anti-LC positive sera from the patients with APECED failed to detect these antigens. Thus, anti-LC autoantibodies detect different antigens in APECED and in AIH.

       Screening with recombinant antigens of sera from patients with APECED

      By indirect immunofluorescence, 50% of patients with APECED hepatitis had anti-LKM/LM, whereas these were only detected in 11% of the patients without hepatitis (Figure 1). Thus, microsomal proteins may be important targets of hepatic autoantibodies in APECED. Several cyp proteins expressed in liver microsomal membranes are autoantigens in immune-mediated drug-induced hepatitis and 3 CYPs active in steroid biosynthesis are autoantigens in adrenal and gonadal failures in APECED.
      • Uibo R
      • Aavik E
      • Peterson P
      • Perheentupa J
      • Aranko S
      • Pelkonen R
      • Krohn KJ
      Autoantibodies to cytochrome P450 enzymes P450scc, P450c17, and P450c21 in autoimmune polyglandular disease types I and II and in isolated Addison's disease.
      • Winqvist O
      • Gebre-Mehedin G
      • Gustafsson J
      • Ritzen EM
      • Lundquist Ö
      • Karlsson FA
      • Kämpe O
      Identification of main gonadal autoantigens in patients with adrenal insufficiency and associated ovarian failure.
      • Krohn K
      • Uibo R
      • Aavik E
      • Peterson P
      • Savilahti K
      Identification by molecular cloning of an auto-antigen associated with Addison disease as steroid 17α-hydroxylase.
      • Beaune PH
      • Pessayre D
      • Dansette P
      • Mansuy D
      • Manns MP
      Autoantibodies against cytochromes P450: role in human diseases.
      Hence, we tested 10 hepatic CYPs, CYP1A1, CYP1A2, CYP2A6, CYP2B6, CYP2C8, CYP2C9, CYP2C18, CYP2D6, CYP2E1, and CYP3A4, by Western blot with sera from the 64 patients with APECED (Figure 3).
      Figure thumbnail gr3
      Fig. 3Autoantibodies directed against CYP1A2 and CYP2A6 do not cross-react with other CYPs. Western blots were performed with microsomes derived from AHH-1 TK+/-derived cell lines, expressing individual CYP isoforms. Western blots were performed with (A) a serum positive for CYP1A2 and (B) a serum positive for CYP2A6. The positions of molecular weight markers are indicated on the right border of the Western blots.
      Also, under identical conditions, microsomes containing recombinant epoxide hydrolase and the cytochrome P450 reductase were tested (data not shown). Only CYP1A1, CYP1A2, CYP2A6, and CYP2B6 were detected by sera from the APECED patients (Figures 3 and 4).
      Figure thumbnail gr4
      Fig. 4Shift in autoantibody patterns in E.B., a patient with APECED hepatitis. Sera obtained from patient EB at different time points were investigated by (A) Western blot and (B) immunoprecipitation with [35S]-labeled protein. Molecular weights as determined with labeled molecular weight standards are indicated on the left border of the Western blots and positive signals obtained with recombinant CYPs expressed in AHH-1 are indicated by arrows. (C) Coincidence of decrease of the anti-CYP1A2 titer and histologic improvement in patient P.S. Sera obtained from patient P.S. at different time points were investigated by immunoprecipitation with [35S]-labeled CYP1A2. The results obtained by liver biopsies are indicated on the top.
      Anti-CYP2A6 was detected in 10 of 64 patients (15.6%) (Figure 2B). Typically, anti-CYP2A6 are very specific. They do not cross-react with any of the closely related proteins of the cytochrome P450 family 2 (Figure 3). Positivity of the 10 anti-CYP2A6 sera was confirmed immunoprecipitation using [35S]-labeled CYP2A6. Only 3 of 10 anti-CYP2A6–positive patients were affected by hepatitis (Figure 2B). Although anti-CYP2A6 was more prevalent in the patients with hepatitis (37.5%) than in those without (14.2%), the majority of the anti-CYP2A6 positive patients had no history of hepatitis. Neither did any other clinical component of APECED show a correlation with anti-CYP2A6.
      Anti-CYP1A2 was detected in 4 of 64 patients (6.3%) with APECED (Figure 2C). They were all affected with hepatitis, whereas none of the 56 patients without hepatitis was anti-CYP1A2 positive. Anti-CYP1A2 failed to cross-react with 6 other closely related CYPs, among them CYP1A1, which shares 67% amino acid identity with CYP1A2. Hence, anti-CYP1A2 is a specific marker for APECED hepatitis. However, not all patients with APECED hepatitis were anti-CYP1A2 positive. Four of 8 APECED patients affected by hepatitis were negative for anti-CYP1A2. Patients without anti-CYP1A2 included a patient with definite hepatitis (P.B.), a patient with acute hepatitis leading to liver necrosis (M.M.), and 2 patients with fluctuating manifestations of hepatitis (T.K. and T.M.). In patient T.M., hepatitis was mild and not treated by immunosuppression (Table 1). CYP1A2 and CYP2A6 were also tested as potential antigens with sera from 68 patients with AIH, 50 healthy controls, and 31 patients with autoimmune rheumatoid diseases. None of these sera recognized either CYP1A2 or CYP2A6. Thus, antibodies against these antigens are rare in the general population and absent in patients with AIH.

       Autoantibody patterns in patients with APECED fluctuate

      Western blots were performed with 5 consecutive sera of patient E.B., who developed hepatitis before the age of 1 year (Table 1). At disease onset, only anti-CYP1A2 autoantibodies were present in his serum. No cross-reactivity was detectable with any other CYP (Figure 4A). Despite continuous immunosuppression, and because of the diagnosis of hepatitis, he had developed additional autoantibodies, namely anti-CYP1A1, anti-CYP2A6, and anti-CYP2B6, by 8 and 9 years (Table 1, Figure 4). At 11 years, when on a combination of prednisone and cyclosporine, his anti-CYP1A2 levels dropped, whereas the anti-CYP2A6 levels remained unaffected (Figure 4). In parallel, weaker signals of anti-CYP1A1 and anti-CYP2B6 were detected at the age of 10 and, finally, at age 11 only weak signals for anti-CYP1A2 and anti-CYP2B6 were present, whereas anti-CYP2A6 was the dominant autoantibody. Thus, autoantibody levels may fluctuate in patients with APECED, and even autoantibody patterns may vary. Patient E.R. (Table 1) showed a moderate decrease of CYP1A2 levels, from 358 U at 14 years to 133 U at 16 years. In parallel, her liver histology markedly improved. Also, patient PS showed a variation in his CYP1A2 titers. At 7.1–8.7 years, results from his liver biopsy specimen revealed severe hepatitis and his anti-CYP1A2 levels were high (Figure 4C). By 9.4 years his liver histology had improved to mild inflammation. Interestingly, his serum samples taken at 15 and 16 years showed only low titers of anti-CYP1A2. Patient E.M. (Table 1), who received no immunosuppressive medication, had an unequivocal chronic active hepatitis at 3 years but only mild inflammation at age 12. At 35 years, he showed no consistent elevation of ALT. In 12 serum samples taken at 12–27 years, his levels of anti-CYP1A2 decreased continuously from 35 U at 12 years to background levels by 20 years (data not shown). Thus the anti-CYP1A2 titers in patients with APECED seem to parallel the severity of hepatitis.

      Discussion

      APECED is caused by mutations in both copies of the AIRE gene on chromosome 21q22.3.
      • Nagamine K
      • Peterson P
      • Scott HS
      • Kudoh J
      • Minoshima S
      • Heino M
      • Krohn KJE
      • Lalioti MD
      • Mullis PE
      • Antonarakis SE
      • Kawasaki K
      • Asakawa S
      • Ito F
      • Shimiziu N
      Positional cloning of the APECED gene.
      • Finnish-German APECED Consortium
      An autoimmune disease, APECED, caused by mutations in a novel gene featuring two PHD-type zinc finger domains.
      • Perheentupa J
      • Miettinen A
      Type 1 autoimmune polyglandular disease.
      In Finnish subjects, 82% of the disease alleles carry a nonsense mutation at position 257.
      • Nagamine K
      • Peterson P
      • Scott HS
      • Kudoh J
      • Minoshima S
      • Heino M
      • Krohn KJE
      • Lalioti MD
      • Mullis PE
      • Antonarakis SE
      • Kawasaki K
      • Asakawa S
      • Ito F
      • Shimiziu N
      Positional cloning of the APECED gene.
      • Finnish-German APECED Consortium
      An autoimmune disease, APECED, caused by mutations in a novel gene featuring two PHD-type zinc finger domains.
      Despite this genetic homogeneity of the Finnish patients, their disease phenotype varies widely.
      • Ahonen P
      • Myllärniemi S
      • Sipilä I
      • Perheentupa J
      Clinical variation of autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) in a series of 68 patients.
      • Perheentupa J
      • Miettinen A
      Type 1 autoimmune polyglandular disease.
      Because defects in a single gene pair induce a broad spectrum of autoimmune diseases, parallel mechanisms have to be involved in the disease processes, affecting endocrine glands, hepatic, and ectodermal targets. The AIRE protein has been shown to be a transcription factor, expressed in thymic medullary epithelial cells and to be up-regulated by thymocytes undergoing negative selection.
      • Zuklys S
      • Balciunaite G
      • Agarwal A
      • Fasler-Kan E
      • Palmer E
      • Hollander GA
      Normal thymic architecture and negative selection are associated with AIRE expression, the gene defective in the autoimmune-polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED).
      In the murine model for diabetes, the nonobese diabetic (NOD) mouse, most AIRE expressing cells were found to show an abnormal morphology.
      • Heino M
      • Peterson P
      • Guerin S
      • Wu L
      • Anderson G
      • Scott HS
      • Antonarakis SE
      • Kudoh J
      • Shimizu N
      • Jenkinson EJ
      • Naquet P
      • Krohn KJ
      RNA and protein expression of the murine autoimmune regulator gene (AIRE) in normal, ReIB-deficient and in NOD mouse.
      Therefore, it has been postulated that a functional AIRE protein may be associated with the normal development and/or action of a subset of thymic medullary cells, which are involved in the induction of tolerance.
      • Zuklys S
      • Balciunaite G
      • Agarwal A
      • Fasler-Kan E
      • Palmer E
      • Hollander GA
      Normal thymic architecture and negative selection are associated with AIRE expression, the gene defective in the autoimmune-polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED).
      • Heino M
      • Peterson P
      • Guerin S
      • Wu L
      • Anderson G
      • Scott HS
      • Antonarakis SE
      • Kudoh J
      • Shimizu N
      • Jenkinson EJ
      • Naquet P
      • Krohn KJ
      RNA and protein expression of the murine autoimmune regulator gene (AIRE) in normal, ReIB-deficient and in NOD mouse.
      Because AIRE is only one of many factors along the signal-transduction pathways, mediating normal development of thymocytes and induction of tolerance, gene defects and polymorphisms affecting related genes may contribute to the genetic predisposition for idiopathic autoimmune diseases. Therefore, APECED may serve as a model disease to study the processes involved and to identify candidate genes contributing to idiopathic autoimmune diseases.
      To study the development of organ-specific autoimmune diseases in APECED and to limit the impact of these diseases on the patients by a timely diagnosis, it is of vital interest to characterize the target antigens involved in the development of different disease components. The main focus of this report is hepatitis, which may show a fulminant onset with lethal outcome and which affects 10%–20% of patients with APECED.
      • Nagamine K
      • Peterson P
      • Scott HS
      • Kudoh J
      • Minoshima S
      • Heino M
      • Krohn KJE
      • Lalioti MD
      • Mullis PE
      • Antonarakis SE
      • Kawasaki K
      • Asakawa S
      • Ito F
      • Shimiziu N
      Positional cloning of the APECED gene.
      • Ahonen P
      • Myllärniemi S
      • Sipilä I
      • Perheentupa J
      Clinical variation of autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) in a series of 68 patients.
      • Perheentupa J
      • Miettinen A
      Type 1 autoimmune polyglandular disease.
      • Neufeld M
      • Maclaren N
      • Blizzard R
      Autoimmune polyglandular syndromes.
      • Betterle C
      • Greggio NA
      • Volpato M
      Autoimmune polyglandular syndrome type 1.
      • Michele TM
      • Fleckenstein J
      • Sgrignoli AR
      • Tuluvath PJ
      Chronic active hepatitis in the type I polyglandular autoimmune syndrome.
      • Clemente M-G
      • Meloni A
      • Obermayer-Straub P
      • Frau F
      • Manns MP
      • DeVirgiliis S
      Two cytochromes P450 are major hepatocellular autoantigens in autoimmune polyglandular syndrome type 1.
      In APECED, hepatitis begins at a pediatric age. In the Finnish cohort, the average age of onset was 7.3 years.
      • Ahonen P
      • Myllärniemi S
      • Sipilä I
      • Perheentupa J
      Clinical variation of autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) in a series of 68 patients.
      Its severity ranged from mild nonsymptomatic increases in serum ALT to death from liver necrosis. Six of 8 patients with hepatitis had to be treated with continuous immunosuppressive medication. Several patients have died from fulminant hepatic failure, which developed without prewarning signs.
      • Ahonen P
      • Myllärniemi S
      • Sipilä I
      • Perheentupa J
      Clinical variation of autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) in a series of 68 patients.
      • Betterle C
      • Greggio NA
      • Volpato M
      Autoimmune polyglandular syndrome type 1.
      • Michele TM
      • Fleckenstein J
      • Sgrignoli AR
      • Tuluvath PJ
      Chronic active hepatitis in the type I polyglandular autoimmune syndrome.
      • Clemente M-G
      • Meloni A
      • Obermayer-Straub P
      • Frau F
      • Manns MP
      • DeVirgiliis S
      Two cytochromes P450 are major hepatocellular autoantigens in autoimmune polyglandular syndrome type 1.
      Therefore, it might be of great importance to know the target antigens of APECED hepatitis as tools for serologic screening. Evidence that autoantibodies may be detected before the manifestation of a new disease component in APECED comes from adrenal and ovarian insufficiencies, where antiadrenal and antisteroidal cell autoantibodies were detected 2–3 years before the manifestation of the corresponding clinical disease.
      • Ahonen P
      • Miettinen A
      • Perheentupa J
      Adrenal and steroidal cell antibodies in patients with autoimmune polyglandular disease type I and risk of adrenocortical and ovarian failure.
      To identify diagnostic markers of APECED hepatitis, we studied the diagnostic value of known markers of AIH. By application of recombinant proteins for autoantibody detection, we showed that the target proteins of autoantibodies in AIH are different from those recognized by patients with APECED, i.e., the SLA/LP-antigen, CYP2D6, FTCD, and ASL. When we applied whole fractions of liver proteins (nuclear fraction, liver microsomes, liver cytosolic proteins), we showed the presence of some positive tests without diagnostic relevance (Figure 1).
      LM or LKM staining patterns were detected in 11% of the Finnish patients without hepatitis and in 50% of those with hepatitis. Similarly, Betterle et al.
      • Betterle C
      • Greggio NA
      • Volpato M
      Autoimmune polyglandular syndrome type 1.
      reported 25% LKM positivity in Italian patients without hepatitis and 75% in those with hepatitis. They did not report LM staining patterns.
      • Betterle C
      • Greggio NA
      • Volpato M
      Autoimmune polyglandular syndrome type 1.
      Because in both Finnish and Italian patients with APECED, microsomal autoantibodies were more frequent in patients with APECED hepatitis, important target antigens in APECED may be expressed in the liver microsomal membrane. The CYPs, a multigene family expressed in that membrane, are known autoantigens in primary adrenocortical and ovarian failures,
      • Uibo R
      • Aavik E
      • Peterson P
      • Perheentupa J
      • Aranko S
      • Pelkonen R
      • Krohn KJ
      Autoantibodies to cytochrome P450 enzymes P450scc, P450c17, and P450c21 in autoimmune polyglandular disease types I and II and in isolated Addison's disease.
      • Winqvist O
      • Gebre-Mehedin G
      • Gustafsson J
      • Ritzen EM
      • Lundquist Ö
      • Karlsson FA
      • Kämpe O
      Identification of main gonadal autoantigens in patients with adrenal insufficiency and associated ovarian failure.
      • Krohn K
      • Uibo R
      • Aavik E
      • Peterson P
      • Savilahti K
      Identification by molecular cloning of an auto-antigen associated with Addison disease as steroid 17α-hydroxylase.
      in AIH
      • Obermayer-Straub P
      • Strassburg CP
      • Manns MP
      Autoimmune hepatitis.
      and in immune-mediated drug-induced hepatitis.
      • Beaune PH
      • Pessayre D
      • Dansette P
      • Mansuy D
      • Manns MP
      Autoantibodies against cytochromes P450: role in human diseases.
      Hence, we screened sera from all 64 patients with APECED for autoantibodies directed against 10 hepatic CYPs, the epoxide hydrolase and the cytochrome P450 reductase. Autoantibodies to CYP1A1, CYP1A2, CYP2A6, and CYP2B6 were detected in some of the patients. These 4 CYPs are expressed at highest levels in the liver. Lower expression levels are detected in other organs.
      • Rodriguez-Antona C
      • Jover R
      • Gomez-Lechon MJ
      • Castell JV
      Quantitative RT-PCR measurement of human cytochrome P-450s: application to drug induction studies.
      Anti-CYP2A6 autoantibodies were detected in 15.6% of Finnish patients with APECED. Similarly, anti-CYP2A6 autoantibodies have been reported in 3 of 11 Sardinian patients with APECED.
      • Clemente M-G
      • Meloni A
      • Obermayer-Straub P
      • Frau F
      • Manns MP
      • DeVirgiliis S
      Two cytochromes P450 are major hepatocellular autoantigens in autoimmune polyglandular syndrome type 1.
      All 3 patients had supranormal transaminase levels, and one of them died from fulminant hepatitis.
      • Clemente M-G
      • Meloni A
      • Obermayer-Straub P
      • Frau F
      • Manns MP
      • DeVirgiliis S
      Two cytochromes P450 are major hepatocellular autoantigens in autoimmune polyglandular syndrome type 1.
      Our studies of the Finnish patient group confirm CYP2A6 as an autoantigen in APECED. In contrast to the Sardinians, a majority of the Finnish patients with anti-CYP2A6 autoantibodies (63%) were not affected by hepatitis. Therefore, CYP2A6 autoantibodies cannot serve as markers for hepatitis in APECED. Of sera from 68 patients with AIH, none recognized CYP2A6. Also, the sera of 31 patients with ARD and 50 healthy controls all failed to recognize CYP2A6. Thus, anti-CYP2A6 autoantibodies present strong evidence for APECED, when detected in a patient with AIH.
      Anti-CYP1A2 was the second anti-CYP autoantibody detected in the patients with APECED. This autoantibody was initially described by Manns et al.
      • Sacher M
      • Blümel P
      • Thaler H
      • Manns M
      Chronic active hepatitis associated with vitiligo, nail dystrophy, alopecia and a new variant of LKM antibodies.
      • Manns MP
      • Griffin KJ
      • Quattrochi L
      • Sacher M
      • Thaler H
      • Tukey RH
      • Johnson EF
      Identification of cytochrome P450 IA2 as a human autoantigen.
      in a patient with “autoimmune hepatitis, vitiligo, alopecia, and nail dystrophy,” retrospectively diagnosed as APECED.
      • Clemente MG
      • Obermayer-Straub P
      • Meloni A
      • Strassburg CP
      • Arangino V
      • Tukey RH
      • De Virgiliis S
      • Manns MP
      Cytochrome P450 1A2 is a hepatic autoantigen in autoimmune polyglandular syndrome type 1.
      The second report described a Sardinian patient with APECED hepatitis, who was the only one with anti-CYP1A2 autoantibodies among 6 patients with APECED.
      • Clemente MG
      • Obermayer-Straub P
      • Meloni A
      • Strassburg CP
      • Arangino V
      • Tukey RH
      • De Virgiliis S
      • Manns MP
      Cytochrome P450 1A2 is a hepatic autoantigen in autoimmune polyglandular syndrome type 1.
      A Swedish study confirmed CYP1A2 as hepatitic autoantigen in APECED; again this autoantibody was detected only in patients with hepatitis.
      • Gebre-Medhin G
      • Husebye ES
      • Gustafsson J
      • Winqvist O
      • Goksoyr A
      • Rorsman F
      • Kämpe O
      Cytochrome P450IA2 and aromatic L-amino acid decarboxylase are hepatic autoantigens in autoimmune polyendocrine syndrome type I.
      The number of patients included in these studies was too low for defining the diagnostic relevance of anti-CYP1A2 autoantibodies for hepatitis in APECED. We investigated 64 patients with APECED including 8 patients with hepatitis. Four patients had developed anti-CYP1A2 autoantibodies and all of them had hepatitis (100%). None of the 56 patients without hepatitis had these autoantibodies. Thus, anti-CYP1A2 is a marker for hepatitis as part of APECED. Otherwise, anti-CYP1A2 autoantibodies have only been reported in patients with dihydralazine-induced hepatitis, where an immune response directed against CYP1A2 is believed to cause LM autoantibody formation and severe, often life-threatening hepatitis.
      • Beaune PH
      • Pessayre D
      • Dansette P
      • Mansuy D
      • Manns MP
      Autoantibodies against cytochromes P450: role in human diseases.
      We did not detect anti-CYP1A2 autoantibodies in any of the sera from patients with autoimmune hepatitis (N = 68), healthy controls (N = 50), or sera from patients with ARD (N = 31). However, anti-CYP1A2 was not detected in all patients with APECED hepatitis. Only 50% of those patients were anti-CYP1A2 positive, indicating that other autoantigens may also play an important role in the pathogenesis of APECED hepatitis. Known hepatic autoantigenes, which may contribute to the pathogenesis of APECED hepatitis, are CYP2A6 and AADC. Autoantibodies against these proteins are more frequently detected in APECED patients with hepatitis than in those without. Prevalences in APECED patients in general were 15.6% for anti-CYP2A6 and 51% for anti-AADC, but 30% and 92%, respectively, in patients with APECED hepatitis.
      • Husebye ES
      • Gebre-Mehedin G
      • Tuomi T
      • Perheentupa J
      • Landin-Olsson M
      • Gustafsson J
      • Rorsman F
      • Kämpe O
      Autoantibodies against aromatic-L-amino acid decarboxylase in autoimmune polyendocrine syndrome.
      Data obtained for the anti-CYP1A2 in our 4 patients with APECED hepatitis even suggests that their titer correlates with the activity of the liver disease. Quantitative determinations of anti-CYP1A2 in patient E.B. revealed that anti-CYP1A2 levels decreased during immunosuppression with prednisone and cyclosporine A, whereas levels of anti-CYP2A6 remained unchanged. Similarly, in patient E.R. severe liver histology was associated with high levels of anti-CYP1A2 autoantibodies and mild inflammation with lower levels. Patient E.M., with a self-limited hepatitis not treated by immunosuppression, had low levels of anti-CYP1A2 autoantibodies, then a continuous decrease to the detection limit. Further studies are needed to correlate the anti-CYP1A2 levels with biochemical and histologic parameters of activity of APECED hepatitis, and its risk of recurrence. Reduction of autoantibody levels during a successful therapy with significant improvement of liver histology has been reported for ANA in AIH.
      • Czaja AJ
      Behavior and significance of autoantibodies in type 1 autoimmune hepatitis.
      However, in AIH even disappearance of ANA during immunosuppression was not predictive for a sustained remission, if immunosuppressive treatment was tapered off.
      • Czaja AJ
      Behavior and significance of autoantibodies in type 1 autoimmune hepatitis.
      We conclude that little overlap exists between autoantibody patterns in AIH and APECED. We showed anti-CYP1A2 as a specific but insensitive marker in patients with APECED hepatitis. Anti-CYP2A6 was shown as another autoantibody in APECED, which is not specifically associated with hepatitis.

      References

        • Nagamine K
        • Peterson P
        • Scott HS
        • Kudoh J
        • Minoshima S
        • Heino M
        • Krohn KJE
        • Lalioti MD
        • Mullis PE
        • Antonarakis SE
        • Kawasaki K
        • Asakawa S
        • Ito F
        • Shimiziu N
        Positional cloning of the APECED gene.
        Nat Genet. 1997; 17: 393-398
        • Finnish-German APECED Consortium
        An autoimmune disease, APECED, caused by mutations in a novel gene featuring two PHD-type zinc finger domains.
        Nat Genet. 1997; 17: 399-403
        • Ahonen P
        • Myllärniemi S
        • Sipilä I
        • Perheentupa J
        Clinical variation of autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) in a series of 68 patients.
        N Engl J Med. 1990; 322: 1829-1836
        • Perheentupa J
        • Miettinen A
        Type 1 autoimmune polyglandular disease.
        Ann Med Intern. 1999; 150: 313-325
        • Uibo R
        • Aavik E
        • Peterson P
        • Perheentupa J
        • Aranko S
        • Pelkonen R
        • Krohn KJ
        Autoantibodies to cytochrome P450 enzymes P450scc, P450c17, and P450c21 in autoimmune polyglandular disease types I and II and in isolated Addison's disease.
        J Clin Endocrinol Metabol. 1994; 78: 323-328
        • Winqvist O
        • Gebre-Mehedin G
        • Gustafsson J
        • Ritzen EM
        • Lundquist Ö
        • Karlsson FA
        • Kämpe O
        Identification of main gonadal autoantigens in patients with adrenal insufficiency and associated ovarian failure.
        J Clin Endocrinol Metabol. 1995; 80: 1717-1723
        • Krohn K
        • Uibo R
        • Aavik E
        • Peterson P
        • Savilahti K
        Identification by molecular cloning of an auto-antigen associated with Addison disease as steroid 17α-hydroxylase.
        Lancet. 1992; 339: 770-773
        • Ekwall O
        • Hedstrand H
        • Grimelius L
        • Haavik J
        • Perheentupa J
        • Gustafsson J
        • Husebye E
        • Kämpe O
        • Rorsman F
        Identification of tryptophan hydroxylase as an intestinal autoantigen.
        Lancet. 1998; 352: 255-256
        • Hedstrand H
        • Ekwall O
        • Haavik J
        • Landgren E
        • Betterle B
        • Perheentupa J
        • Gustafsson J
        • Huse-bye E
        • Rorsman F
        • Kämpe O
        Identification of tyrosine hydroxylase as an autoantigen in auto-immune polyendocrine syndrome type I.
        Biochem Biophys Res Comm. 2000; 267: 456-461
        • Ahonen P
        • Miettinen A
        • Perheentupa J
        Adrenal and steroidal cell antibodies in patients with autoimmune polyglandular disease type I and risk of adrenocortical and ovarian failure.
        J Clin Endocrinol Metabol. 1987; 64: 494-500
        • Neufeld M
        • Maclaren N
        • Blizzard R
        Autoimmune polyglandular syndromes.
        Pediatr Ann. 1980; 9: 154-162
        • Betterle C
        • Greggio NA
        • Volpato M
        Autoimmune polyglandular syndrome type 1.
        J Clin Endocrinol Metab. 1998; 83: 1049-1055
        • Michele TM
        • Fleckenstein J
        • Sgrignoli AR
        • Tuluvath PJ
        Chronic active hepatitis in the type I polyglandular autoimmune syndrome.
        J Postgrad Med. 1994; 70: 128-131
        • Clemente M-G
        • Meloni A
        • Obermayer-Straub P
        • Frau F
        • Manns MP
        • DeVirgiliis S
        Two cytochromes P450 are major hepatocellular autoantigens in autoimmune polyglandular syndrome type 1.
        Gastroenterology. 1998; 114: 324-328
        • Obermayer-Straub P
        • Strassburg CP
        • Manns MP
        Autoimmune hepatitis.
        J Hepatol. 2000; 31: 181-197
        • Czaja AJ
        • Manns MP
        The validity and importance of subtypes in autoimmune hepatitis: a point of view.
        Am J Gastroenterol. 1995; 90: 1206-1211
        • Manns M
        • Gerken G
        • Kyriatsoulis A
        • Staritz M
        • Meyer zum Büschenfelde KH
        Characterization of a new subgroup of autoimmune chronic active hepatitis by autoantibodies against a soluble liver antigen.
        Lancet. 1987; 1: 292-294
        • Stechemesser E
        • Klein R
        • Berg PA
        Characterization and clinical relevance of liver-pancreas antibodies in autoimmune hepatitis.
        Hepatology. 1993; 18: 1-9
        • Wies I
        • Brunner S
        • Henninger J
        • Herkel J
        • Kanzler S
        • Meyer zum Büschenfelde KH
        • Lohse AW
        Identification of target antigen for SLA/Lp autoantibodies un autoimmune hepatitis.
        Lancet. 2000; 355: 1510-1515
        • Targan SR
        • Landers C
        • Vidrich A
        • Czaja AJ
        High titer antineutrophil cytoplasmic antibodies in type-1 autoimmune hepatitis.
        Gastroenterology. 1995; 108: 1159-1166
        • Martini E
        • Abuaf N
        • Cavalli F
        • Durand V
        • Johanet C
        • Homberg JC
        Antibody to liver cytosol (anti-LC1) in patients with autoimmune hepatitis type 2.
        Hepatology. 1988; 8: 1662-1666
        • Strassburg C
        • Obermayer-Straub P
        • Alex B
        • Durazzo M
        • Rizzetto M
        • Tukey RH
        • Manns MP
        Autoantibodies against glucuronosyltransferases differ between viral hepatitis and autoimmune hepatitis.
        Gastroenterology. 1996; 11: 1582-1592
        • Clemente MG
        • Obermayer-Straub P
        • Meloni A
        • Strassburg CP
        • Arangino V
        • Tukey RH
        • De Virgiliis S
        • Manns MP
        Cytochrome P450 1A2 is a hepatic autoantigen in autoimmune polyglandular syndrome type 1.
        J Clin Endocrinol Metabol. 1997; 82: 1353-1361
        • Gebre-Medhin G
        • Husebye ES
        • Gustafsson J
        • Winqvist O
        • Goksoyr A
        • Rorsman F
        • Kämpe O
        Cytochrome P450IA2 and aromatic L-amino acid decarboxylase are hepatic autoantigens in autoimmune polyendocrine syndrome type I.
        FEBS Lett. 1997; 412: 439-445
        • Husebye ES
        • Gebre-Mehedin G
        • Tuomi T
        • Perheentupa J
        • Landin-Olsson M
        • Gustafsson J
        • Rorsman F
        • Kämpe O
        Autoantibodies against aromatic-L-amino acid decarboxylase in autoimmune polyendocrine syndrome.
        J Clin Endocrinol Metabol. 1997; 82: 147-150
        • Sacher M
        • Blümel P
        • Thaler H
        • Manns M
        Chronic active hepatitis associated with vitiligo, nail dystrophy, alopecia and a new variant of LKM antibodies.
        J Hepatol. 1990; 10: 364-369
        • Manns MP
        • Griffin KJ
        • Quattrochi L
        • Sacher M
        • Thaler H
        • Tukey RH
        • Johnson EF
        Identification of cytochrome P450 IA2 as a human autoantigen.
        Arch Biochem Biophys. 1990; 280: 229-232
        • Strassburg C
        • Alex B
        • Zindy F
        • Gerken G
        • Lüttig B
        • Meyer zum Büschenfelde KH
        • Bréchot C
        • Manns M
        Identification of cyclin A as a molecular target of antinuclear antibodies (ANA) in hepatic and non-hepatic diseases.
        J Hepatol. 1996; 25: 859-866
        • Dalekos GN
        • Wedemeyer H
        • Obermayer-Straub P
        • Kayser A
        • Barut A
        • Frank H
        • Manns MP
        Epitope mapping of cytochrome P4502D6 autoantigen in patients with chronic hepatitis C during α-interferon treatment.
        J Hepatol. 1999; 30: 366-375
        • Lapierre P
        • Hajoui O
        • Homberg J-C
        • Alvarez F
        Fomiminotransferase cyclodeaminase is an organ specific autoantigen recognized by sera of patients with autoimmune hepatitis.
        Gastroenterology. 1999; 116: 643-649
        • Homberg JC
        • Abuaf N
        • Bernard O
        • Islam S
        • Alvarez F
        • Khalil SH
        • Poupon R
        • Darnis F
        • Levy VG
        • Grippon P
        Chronic active hepatitis associated with anti liver/kidney microsome type 1: a second type of “autoimmune” hepatitis.
        Hepatology. 1987; 7: 1333-1339
        • Pelli N
        • Fensom AH
        • Slade C
        • Boa F
        • Mieli-Vergani G
        • Vergani D
        Argininosuccinate lyase: a new autoantigen in liver disease.
        Clin Exp Immunol. 1998; 114: 455-461
        • Beaune PH
        • Pessayre D
        • Dansette P
        • Mansuy D
        • Manns MP
        Autoantibodies against cytochromes P450: role in human diseases.
        Adv Pharmacol. 1994; 30: 199-245
        • Zuklys S
        • Balciunaite G
        • Agarwal A
        • Fasler-Kan E
        • Palmer E
        • Hollander GA
        Normal thymic architecture and negative selection are associated with AIRE expression, the gene defective in the autoimmune-polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED).
        J Immunol. 2000; 65: 1976-1983
        • Heino M
        • Peterson P
        • Guerin S
        • Wu L
        • Anderson G
        • Scott HS
        • Antonarakis SE
        • Kudoh J
        • Shimizu N
        • Jenkinson EJ
        • Naquet P
        • Krohn KJ
        RNA and protein expression of the murine autoimmune regulator gene (AIRE) in normal, ReIB-deficient and in NOD mouse.
        Eur J Immunol. 2000; 30: 1884-1893
        • Rodriguez-Antona C
        • Jover R
        • Gomez-Lechon MJ
        • Castell JV
        Quantitative RT-PCR measurement of human cytochrome P-450s: application to drug induction studies.
        Arch Biochem Biophys. 2000; 376: 109-116
        • Czaja AJ
        Behavior and significance of autoantibodies in type 1 autoimmune hepatitis.
        J Hepatol. 1999; 30: 394-401